ID: 1192211234

View in Genome Browser
Species Human (GRCh38)
Location X:69129176-69129198
Sequence GCTCCCCAGCTCTTTCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192211228_1192211234 26 Left 1192211228 X:69129127-69129149 CCTCTCCTCTCTCTTGAGTCTGT No data
Right 1192211234 X:69129176-69129198 GCTCCCCAGCTCTTTCCCCATGG No data
1192211233_1192211234 -4 Left 1192211233 X:69129157-69129179 CCTGGTGCTTAGCTGCGAGGCTC No data
Right 1192211234 X:69129176-69129198 GCTCCCCAGCTCTTTCCCCATGG No data
1192211229_1192211234 21 Left 1192211229 X:69129132-69129154 CCTCTCTCTTGAGTCTGTGCTTG No data
Right 1192211234 X:69129176-69129198 GCTCCCCAGCTCTTTCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192211234 Original CRISPR GCTCCCCAGCTCTTTCCCCA TGG Intergenic
No off target data available for this crispr