ID: 1192211531

View in Genome Browser
Species Human (GRCh38)
Location X:69130900-69130922
Sequence GCATCAGTTTAACCTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192211531_1192211538 -4 Left 1192211531 X:69130900-69130922 CCCTTCCCAGGTTAAACTGATGC No data
Right 1192211538 X:69130919-69130941 ATGCCTTCTGGCTTCCAATGGGG No data
1192211531_1192211536 -6 Left 1192211531 X:69130900-69130922 CCCTTCCCAGGTTAAACTGATGC No data
Right 1192211536 X:69130917-69130939 TGATGCCTTCTGGCTTCCAATGG No data
1192211531_1192211541 18 Left 1192211531 X:69130900-69130922 CCCTTCCCAGGTTAAACTGATGC No data
Right 1192211541 X:69130941-69130963 GAGCAGAAATCAGCCAGCTTAGG No data
1192211531_1192211537 -5 Left 1192211531 X:69130900-69130922 CCCTTCCCAGGTTAAACTGATGC No data
Right 1192211537 X:69130918-69130940 GATGCCTTCTGGCTTCCAATGGG No data
1192211531_1192211542 19 Left 1192211531 X:69130900-69130922 CCCTTCCCAGGTTAAACTGATGC No data
Right 1192211542 X:69130942-69130964 AGCAGAAATCAGCCAGCTTAGGG No data
1192211531_1192211543 20 Left 1192211531 X:69130900-69130922 CCCTTCCCAGGTTAAACTGATGC No data
Right 1192211543 X:69130943-69130965 GCAGAAATCAGCCAGCTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192211531 Original CRISPR GCATCAGTTTAACCTGGGAA GGG (reversed) Intergenic
No off target data available for this crispr