ID: 1192214187

View in Genome Browser
Species Human (GRCh38)
Location X:69146828-69146850
Sequence CTATATTACAATGAGAAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192214186_1192214187 -4 Left 1192214186 X:69146809-69146831 CCTTCTCTAGATATTACAACTAT No data
Right 1192214187 X:69146828-69146850 CTATATTACAATGAGAAGATTGG No data
1192214185_1192214187 21 Left 1192214185 X:69146784-69146806 CCAGGGAGCTTGAATAAATACTT No data
Right 1192214187 X:69146828-69146850 CTATATTACAATGAGAAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192214187 Original CRISPR CTATATTACAATGAGAAGAT TGG Intergenic
No off target data available for this crispr