ID: 1192216398

View in Genome Browser
Species Human (GRCh38)
Location X:69162336-69162358
Sequence CGAGTGGCCCTCATTGTCAT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 56}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192216392_1192216398 -2 Left 1192216392 X:69162315-69162337 CCCTCTTCTTGCCAGGCCATCCG 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1192216398 X:69162336-69162358 CGAGTGGCCCTCATTGTCATTGG 0: 1
1: 0
2: 0
3: 6
4: 56
1192216393_1192216398 -3 Left 1192216393 X:69162316-69162338 CCTCTTCTTGCCAGGCCATCCGA 0: 1
1: 0
2: 1
3: 4
4: 143
Right 1192216398 X:69162336-69162358 CGAGTGGCCCTCATTGTCATTGG 0: 1
1: 0
2: 0
3: 6
4: 56
1192216391_1192216398 3 Left 1192216391 X:69162310-69162332 CCTCTCCCTCTTCTTGCCAGGCC 0: 1
1: 0
2: 4
3: 50
4: 549
Right 1192216398 X:69162336-69162358 CGAGTGGCCCTCATTGTCATTGG 0: 1
1: 0
2: 0
3: 6
4: 56
1192216389_1192216398 18 Left 1192216389 X:69162295-69162317 CCACTTGAACTCTCGCCTCTCCC 0: 1
1: 0
2: 3
3: 15
4: 249
Right 1192216398 X:69162336-69162358 CGAGTGGCCCTCATTGTCATTGG 0: 1
1: 0
2: 0
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192216398 Original CRISPR CGAGTGGCCCTCATTGTCAT TGG Exonic
901325230 1:8361332-8361354 CGAGTCACTCTCATTGTCCTGGG + Exonic
902721916 1:18309573-18309595 AGAGAGGCCCACATTGTCAAAGG - Intronic
905024842 1:34842981-34843003 CGCCTGGCTCTCATTGTCATTGG - Intronic
906933513 1:50191893-50191915 AGGGTGACCCTCATTGCCATGGG + Intronic
914970655 1:152305817-152305839 TGAATGTCCCTCATTGTCACTGG + Exonic
914970810 1:152306789-152306811 TGAATGTCCCTCATTGTCACTGG + Exonic
916745773 1:167683916-167683938 CGAGTTGTCCACATTGGCATTGG - Exonic
922703218 1:227774440-227774462 AGAGTGGCCCTCAATGGCAGGGG + Intronic
1067531152 10:47074543-47074565 AGAGGGGTCCTCATTTTCATGGG - Intergenic
1070674318 10:78401882-78401904 GGAGAGGCACTCATTGGCATTGG - Intergenic
1075691084 10:124394614-124394636 CCAAAGGCCCTCATTGTCATTGG + Intergenic
1082920221 11:58484778-58484800 CTAGTGGGCCTCTTTGGCATGGG + Intergenic
1086856360 11:91870931-91870953 CAAGTGGCATTAATTGTCATCGG - Intergenic
1106770772 13:32958784-32958806 CCAGTGGGTCTCATGGTCATGGG + Intergenic
1108212196 13:48150202-48150224 CCAGTGGCCCCCATCATCATGGG - Intergenic
1112318823 13:98388889-98388911 CCAGTGGAACTCATTTTCATGGG + Intronic
1137796024 16:51220903-51220925 CCAGTGGCCATCACTGGCATAGG + Intergenic
1138063605 16:53917130-53917152 TGAGTGGCCCAGATTCTCATGGG - Intronic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1147287074 17:39410686-39410708 CGAATAGCCCTCATCGTCACAGG + Exonic
1152186577 17:78860510-78860532 CAAGTGGCCTCCATTGTCCTGGG + Intronic
1157291143 18:46410729-46410751 TGAGTGGCCCTCCTGGTCATGGG - Intronic
1157712700 18:49860893-49860915 AGGGTGGCCCTCATGGTAATGGG + Intronic
1163687398 19:18719550-18719572 CGAGATGCCCTCATTACCATGGG - Intronic
1165113017 19:33513110-33513132 AGAGTGGCCCCCAGGGTCATGGG - Intronic
1165716368 19:38048382-38048404 CAAGTGGCCCTGATTATCACTGG - Intronic
1166442227 19:42824949-42824971 GAAGTGGCCCTCAGTGTCAAAGG + Intronic
1166461665 19:42993258-42993280 GAAGTGGCCCTCAGTGTCAAAGG + Intronic
1166501620 19:43345556-43345578 GAAGTGGCCCTCAGTGTCAAAGG + Intergenic
1167663958 19:50812404-50812426 GGGATGGTCCTCATTGTCATAGG - Intergenic
924996751 2:368475-368497 CGAGAGCCCCTCATTATCAGTGG + Intergenic
927262203 2:21102804-21102826 GGAGTTGCTCTCAGTGTCATGGG + Intergenic
927889445 2:26739115-26739137 CCATTGGCCCTCACTGTCACAGG + Intergenic
929865688 2:45715513-45715535 CCAGTGTCCTTCATTGTCACAGG + Intronic
933225257 2:79741032-79741054 GGAGTGGCATGCATTGTCATAGG + Intronic
938744071 2:134260382-134260404 CGATTGGCCCTCATTGGCTTGGG + Intronic
948092746 2:235308441-235308463 CCAGTGTCCCACACTGTCATTGG + Intergenic
1168828912 20:833760-833782 CGGGTGGCCCTCACTGTCGAAGG - Exonic
1179114754 21:38480065-38480087 CGAGTAGCCCTCTTGGTTATGGG - Intronic
1179585132 21:42370007-42370029 CGAGAGCCCCTCATTTTCAGTGG + Intergenic
953662038 3:44898531-44898553 AGAGTGGTCCTCACTGGCATTGG - Intronic
958997133 3:100917597-100917619 CTAATGGCCCTTTTTGTCATGGG - Intronic
966898190 3:184461481-184461503 GGTGTGGCCCTCATTGCCAGTGG + Intronic
969305110 4:6321832-6321854 TCTGTGGCCCTCATTGTCAGAGG + Exonic
979107460 4:116705770-116705792 CGCGTGGCCTTCATTCTCCTCGG + Intergenic
980482027 4:133399530-133399552 CCAATGGACCTCATGGTCATGGG + Intergenic
981039698 4:140211857-140211879 CTAGTGGATCTCATCGTCATAGG + Intergenic
1009717586 6:67419390-67419412 CGTGTGGGTCTCATTGTGATTGG - Intergenic
1012783862 6:103598112-103598134 TGAGTGGCAATCATTGTAATAGG + Intergenic
1014276448 6:119395204-119395226 CCAGTGGCCTTCATTGCCGTAGG + Intergenic
1036658159 8:10690919-10690941 GGAGTGGCCCTCATTTGCATTGG - Intronic
1036687336 8:10920811-10920833 CCAGTGGCCATCCTTGTCATTGG - Intronic
1037917932 8:22784015-22784037 AGAGTGGCTCTCATTGACCTTGG + Intronic
1043690190 8:83141376-83141398 CAAGAGGCCCTCTTGGTCATAGG + Intergenic
1044834523 8:96282838-96282860 GGAGTGGCTCACAGTGTCATAGG + Intronic
1046640905 8:116730301-116730323 CCAGTGGCACTGATTCTCATAGG + Intronic
1055288943 9:74762352-74762374 AGAGGGGAGCTCATTGTCATGGG + Exonic
1057293041 9:93819236-93819258 AGAGTGGCCCTAGTTGACATCGG + Intergenic
1185871486 X:3668485-3668507 AGTGTGGTCCCCATTGTCATTGG - Intronic
1192216398 X:69162336-69162358 CGAGTGGCCCTCATTGTCATTGG + Exonic
1197551838 X:127901277-127901299 GGAGTGTCCCCCATTGTCCTTGG - Intergenic
1198102136 X:133431444-133431466 CCAGTGGTCCTCATGGTCAGAGG + Intergenic