ID: 1192218385

View in Genome Browser
Species Human (GRCh38)
Location X:69179786-69179808
Sequence CTCACCTCTGCTGAGTGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192218380_1192218385 25 Left 1192218380 X:69179738-69179760 CCTGTAGTGGCTTGGGGGAGGGC No data
Right 1192218385 X:69179786-69179808 CTCACCTCTGCTGAGTGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192218385 Original CRISPR CTCACCTCTGCTGAGTGGCG TGG Intergenic
No off target data available for this crispr