ID: 1192220770

View in Genome Browser
Species Human (GRCh38)
Location X:69196004-69196026
Sequence CCAGTTCAGAATCTATTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192220770_1192220779 22 Left 1192220770 X:69196004-69196026 CCTATTAATAGATTCTGAACTGG No data
Right 1192220779 X:69196049-69196071 CCTCTGTTCTAGAGCTAGGATGG No data
1192220770_1192220780 23 Left 1192220770 X:69196004-69196026 CCTATTAATAGATTCTGAACTGG No data
Right 1192220780 X:69196050-69196072 CTCTGTTCTAGAGCTAGGATGGG No data
1192220770_1192220777 18 Left 1192220770 X:69196004-69196026 CCTATTAATAGATTCTGAACTGG No data
Right 1192220777 X:69196045-69196067 ATTGCCTCTGTTCTAGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192220770 Original CRISPR CCAGTTCAGAATCTATTAAT AGG (reversed) Intergenic
No off target data available for this crispr