ID: 1192220777

View in Genome Browser
Species Human (GRCh38)
Location X:69196045-69196067
Sequence ATTGCCTCTGTTCTAGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192220772_1192220777 -7 Left 1192220772 X:69196029-69196051 CCTCCCCTCACCGTGCATTGCCT No data
Right 1192220777 X:69196045-69196067 ATTGCCTCTGTTCTAGAGCTAGG No data
1192220773_1192220777 -10 Left 1192220773 X:69196032-69196054 CCCCTCACCGTGCATTGCCTCTG No data
Right 1192220777 X:69196045-69196067 ATTGCCTCTGTTCTAGAGCTAGG No data
1192220770_1192220777 18 Left 1192220770 X:69196004-69196026 CCTATTAATAGATTCTGAACTGG No data
Right 1192220777 X:69196045-69196067 ATTGCCTCTGTTCTAGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192220777 Original CRISPR ATTGCCTCTGTTCTAGAGCT AGG Intergenic
No off target data available for this crispr