ID: 1192220779

View in Genome Browser
Species Human (GRCh38)
Location X:69196049-69196071
Sequence CCTCTGTTCTAGAGCTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192220774_1192220779 -7 Left 1192220774 X:69196033-69196055 CCCTCACCGTGCATTGCCTCTGT No data
Right 1192220779 X:69196049-69196071 CCTCTGTTCTAGAGCTAGGATGG No data
1192220772_1192220779 -3 Left 1192220772 X:69196029-69196051 CCTCCCCTCACCGTGCATTGCCT No data
Right 1192220779 X:69196049-69196071 CCTCTGTTCTAGAGCTAGGATGG No data
1192220770_1192220779 22 Left 1192220770 X:69196004-69196026 CCTATTAATAGATTCTGAACTGG No data
Right 1192220779 X:69196049-69196071 CCTCTGTTCTAGAGCTAGGATGG No data
1192220775_1192220779 -8 Left 1192220775 X:69196034-69196056 CCTCACCGTGCATTGCCTCTGTT No data
Right 1192220779 X:69196049-69196071 CCTCTGTTCTAGAGCTAGGATGG No data
1192220773_1192220779 -6 Left 1192220773 X:69196032-69196054 CCCCTCACCGTGCATTGCCTCTG No data
Right 1192220779 X:69196049-69196071 CCTCTGTTCTAGAGCTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192220779 Original CRISPR CCTCTGTTCTAGAGCTAGGA TGG Intergenic
No off target data available for this crispr