ID: 1192220780

View in Genome Browser
Species Human (GRCh38)
Location X:69196050-69196072
Sequence CTCTGTTCTAGAGCTAGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192220770_1192220780 23 Left 1192220770 X:69196004-69196026 CCTATTAATAGATTCTGAACTGG No data
Right 1192220780 X:69196050-69196072 CTCTGTTCTAGAGCTAGGATGGG No data
1192220775_1192220780 -7 Left 1192220775 X:69196034-69196056 CCTCACCGTGCATTGCCTCTGTT No data
Right 1192220780 X:69196050-69196072 CTCTGTTCTAGAGCTAGGATGGG No data
1192220772_1192220780 -2 Left 1192220772 X:69196029-69196051 CCTCCCCTCACCGTGCATTGCCT No data
Right 1192220780 X:69196050-69196072 CTCTGTTCTAGAGCTAGGATGGG No data
1192220773_1192220780 -5 Left 1192220773 X:69196032-69196054 CCCCTCACCGTGCATTGCCTCTG No data
Right 1192220780 X:69196050-69196072 CTCTGTTCTAGAGCTAGGATGGG No data
1192220774_1192220780 -6 Left 1192220774 X:69196033-69196055 CCCTCACCGTGCATTGCCTCTGT No data
Right 1192220780 X:69196050-69196072 CTCTGTTCTAGAGCTAGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192220780 Original CRISPR CTCTGTTCTAGAGCTAGGAT GGG Intergenic
No off target data available for this crispr