ID: 1192221017

View in Genome Browser
Species Human (GRCh38)
Location X:69197386-69197408
Sequence AAGATTGGCAAGCAGGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192221006_1192221017 25 Left 1192221006 X:69197338-69197360 CCATTACAGCTGGAAAATTGAGG No data
Right 1192221017 X:69197386-69197408 AAGATTGGCAAGCAGGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192221017 Original CRISPR AAGATTGGCAAGCAGGTTGA TGG Intergenic
No off target data available for this crispr