ID: 1192223342

View in Genome Browser
Species Human (GRCh38)
Location X:69212095-69212117
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192223342_1192223346 4 Left 1192223342 X:69212095-69212117 CCTACTCATCATACAGGTCCCAG No data
Right 1192223346 X:69212122-69212144 AATACTGACCTACTCTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192223342 Original CRISPR CTGGGACCTGTATGATGAGT AGG (reversed) Intergenic
No off target data available for this crispr