ID: 1192225003

View in Genome Browser
Species Human (GRCh38)
Location X:69221881-69221903
Sequence TGAAACGTAAGTTTTGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192224997_1192225003 0 Left 1192224997 X:69221858-69221880 CCCAGCCAAAAAGGGGCTCACTT 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1192225003 X:69221881-69221903 TGAAACGTAAGTTTTGGGAAGGG No data
1192224999_1192225003 -5 Left 1192224999 X:69221863-69221885 CCAAAAAGGGGCTCACTTTGAAA No data
Right 1192225003 X:69221881-69221903 TGAAACGTAAGTTTTGGGAAGGG No data
1192224987_1192225003 26 Left 1192224987 X:69221832-69221854 CCCCCTTCTCCGCGTCGCCGCTG No data
Right 1192225003 X:69221881-69221903 TGAAACGTAAGTTTTGGGAAGGG No data
1192224998_1192225003 -1 Left 1192224998 X:69221859-69221881 CCAGCCAAAAAGGGGCTCACTTT No data
Right 1192225003 X:69221881-69221903 TGAAACGTAAGTTTTGGGAAGGG No data
1192224990_1192225003 23 Left 1192224990 X:69221835-69221857 CCTTCTCCGCGTCGCCGCTGTGG No data
Right 1192225003 X:69221881-69221903 TGAAACGTAAGTTTTGGGAAGGG No data
1192224992_1192225003 17 Left 1192224992 X:69221841-69221863 CCGCGTCGCCGCTGTGGCCCAGC No data
Right 1192225003 X:69221881-69221903 TGAAACGTAAGTTTTGGGAAGGG No data
1192224989_1192225003 24 Left 1192224989 X:69221834-69221856 CCCTTCTCCGCGTCGCCGCTGTG No data
Right 1192225003 X:69221881-69221903 TGAAACGTAAGTTTTGGGAAGGG No data
1192224993_1192225003 9 Left 1192224993 X:69221849-69221871 CCGCTGTGGCCCAGCCAAAAAGG No data
Right 1192225003 X:69221881-69221903 TGAAACGTAAGTTTTGGGAAGGG No data
1192224988_1192225003 25 Left 1192224988 X:69221833-69221855 CCCCTTCTCCGCGTCGCCGCTGT No data
Right 1192225003 X:69221881-69221903 TGAAACGTAAGTTTTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192225003 Original CRISPR TGAAACGTAAGTTTTGGGAA GGG Intergenic