ID: 1192226343

View in Genome Browser
Species Human (GRCh38)
Location X:69230800-69230822
Sequence CAGTGTGAAGGCAGTAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192226343_1192226348 -3 Left 1192226343 X:69230800-69230822 CCCACTCTACTGCCTTCACACTG No data
Right 1192226348 X:69230820-69230842 CTGCCAGGGTACTGACCAAATGG No data
1192226343_1192226353 24 Left 1192226343 X:69230800-69230822 CCCACTCTACTGCCTTCACACTG No data
Right 1192226353 X:69230847-69230869 CCTCAGTTTCTCAAACATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192226343 Original CRISPR CAGTGTGAAGGCAGTAGAGT GGG (reversed) Intergenic
No off target data available for this crispr