ID: 1192226348

View in Genome Browser
Species Human (GRCh38)
Location X:69230820-69230842
Sequence CTGCCAGGGTACTGACCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192226343_1192226348 -3 Left 1192226343 X:69230800-69230822 CCCACTCTACTGCCTTCACACTG No data
Right 1192226348 X:69230820-69230842 CTGCCAGGGTACTGACCAAATGG No data
1192226335_1192226348 27 Left 1192226335 X:69230770-69230792 CCCAGCCCCATTCTCTTTGAGAC No data
Right 1192226348 X:69230820-69230842 CTGCCAGGGTACTGACCAAATGG No data
1192226339_1192226348 20 Left 1192226339 X:69230777-69230799 CCATTCTCTTTGAGACCTTCCCA No data
Right 1192226348 X:69230820-69230842 CTGCCAGGGTACTGACCAAATGG No data
1192226342_1192226348 0 Left 1192226342 X:69230797-69230819 CCACCCACTCTACTGCCTTCACA No data
Right 1192226348 X:69230820-69230842 CTGCCAGGGTACTGACCAAATGG No data
1192226336_1192226348 26 Left 1192226336 X:69230771-69230793 CCAGCCCCATTCTCTTTGAGACC No data
Right 1192226348 X:69230820-69230842 CTGCCAGGGTACTGACCAAATGG No data
1192226338_1192226348 21 Left 1192226338 X:69230776-69230798 CCCATTCTCTTTGAGACCTTCCC No data
Right 1192226348 X:69230820-69230842 CTGCCAGGGTACTGACCAAATGG No data
1192226340_1192226348 5 Left 1192226340 X:69230792-69230814 CCTTCCCACCCACTCTACTGCCT No data
Right 1192226348 X:69230820-69230842 CTGCCAGGGTACTGACCAAATGG No data
1192226334_1192226348 28 Left 1192226334 X:69230769-69230791 CCCCAGCCCCATTCTCTTTGAGA No data
Right 1192226348 X:69230820-69230842 CTGCCAGGGTACTGACCAAATGG No data
1192226341_1192226348 1 Left 1192226341 X:69230796-69230818 CCCACCCACTCTACTGCCTTCAC No data
Right 1192226348 X:69230820-69230842 CTGCCAGGGTACTGACCAAATGG No data
1192226337_1192226348 22 Left 1192226337 X:69230775-69230797 CCCCATTCTCTTTGAGACCTTCC No data
Right 1192226348 X:69230820-69230842 CTGCCAGGGTACTGACCAAATGG No data
1192226344_1192226348 -4 Left 1192226344 X:69230801-69230823 CCACTCTACTGCCTTCACACTGC No data
Right 1192226348 X:69230820-69230842 CTGCCAGGGTACTGACCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192226348 Original CRISPR CTGCCAGGGTACTGACCAAA TGG Intergenic
No off target data available for this crispr