ID: 1192226353

View in Genome Browser
Species Human (GRCh38)
Location X:69230847-69230869
Sequence CCTCAGTTTCTCAAACATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192226341_1192226353 28 Left 1192226341 X:69230796-69230818 CCCACCCACTCTACTGCCTTCAC No data
Right 1192226353 X:69230847-69230869 CCTCAGTTTCTCAAACATGCTGG No data
1192226343_1192226353 24 Left 1192226343 X:69230800-69230822 CCCACTCTACTGCCTTCACACTG No data
Right 1192226353 X:69230847-69230869 CCTCAGTTTCTCAAACATGCTGG No data
1192226344_1192226353 23 Left 1192226344 X:69230801-69230823 CCACTCTACTGCCTTCACACTGC No data
Right 1192226353 X:69230847-69230869 CCTCAGTTTCTCAAACATGCTGG No data
1192226342_1192226353 27 Left 1192226342 X:69230797-69230819 CCACCCACTCTACTGCCTTCACA No data
Right 1192226353 X:69230847-69230869 CCTCAGTTTCTCAAACATGCTGG No data
1192226349_1192226353 1 Left 1192226349 X:69230823-69230845 CCAGGGTACTGACCAAATGGCCA No data
Right 1192226353 X:69230847-69230869 CCTCAGTTTCTCAAACATGCTGG No data
1192226347_1192226353 12 Left 1192226347 X:69230812-69230834 CCTTCACACTGCCAGGGTACTGA No data
Right 1192226353 X:69230847-69230869 CCTCAGTTTCTCAAACATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192226353 Original CRISPR CCTCAGTTTCTCAAACATGC TGG Intergenic
No off target data available for this crispr