ID: 1192233123

View in Genome Browser
Species Human (GRCh38)
Location X:69279335-69279357
Sequence CAGAAGAGACAGAGGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192233123_1192233128 -2 Left 1192233123 X:69279335-69279357 CCCTGTTCCCTCTGTCTCTTCTG No data
Right 1192233128 X:69279356-69279378 TGACTCAGGACTGCCCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192233123 Original CRISPR CAGAAGAGACAGAGGGAACA GGG (reversed) Intergenic
No off target data available for this crispr