ID: 1192235919

View in Genome Browser
Species Human (GRCh38)
Location X:69296041-69296063
Sequence TGATGAATTCCACAAGCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192235919_1192235928 30 Left 1192235919 X:69296041-69296063 CCCCACGCTTGTGGAATTCATCA No data
Right 1192235928 X:69296094-69296116 CCCTTCAGAGCTTCCCACTGAGG No data
1192235919_1192235922 -8 Left 1192235919 X:69296041-69296063 CCCCACGCTTGTGGAATTCATCA No data
Right 1192235922 X:69296056-69296078 ATTCATCAGCGAAGTGTCAGAGG No data
1192235919_1192235923 -4 Left 1192235919 X:69296041-69296063 CCCCACGCTTGTGGAATTCATCA No data
Right 1192235923 X:69296060-69296082 ATCAGCGAAGTGTCAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192235919 Original CRISPR TGATGAATTCCACAAGCGTG GGG (reversed) Intergenic