ID: 1192235921

View in Genome Browser
Species Human (GRCh38)
Location X:69296043-69296065
Sequence GCTGATGAATTCCACAAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192235921_1192235922 -10 Left 1192235921 X:69296043-69296065 CCACGCTTGTGGAATTCATCAGC No data
Right 1192235922 X:69296056-69296078 ATTCATCAGCGAAGTGTCAGAGG No data
1192235921_1192235928 28 Left 1192235921 X:69296043-69296065 CCACGCTTGTGGAATTCATCAGC No data
Right 1192235928 X:69296094-69296116 CCCTTCAGAGCTTCCCACTGAGG No data
1192235921_1192235923 -6 Left 1192235921 X:69296043-69296065 CCACGCTTGTGGAATTCATCAGC No data
Right 1192235923 X:69296060-69296082 ATCAGCGAAGTGTCAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192235921 Original CRISPR GCTGATGAATTCCACAAGCG TGG (reversed) Intergenic