ID: 1192235922

View in Genome Browser
Species Human (GRCh38)
Location X:69296056-69296078
Sequence ATTCATCAGCGAAGTGTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192235921_1192235922 -10 Left 1192235921 X:69296043-69296065 CCACGCTTGTGGAATTCATCAGC No data
Right 1192235922 X:69296056-69296078 ATTCATCAGCGAAGTGTCAGAGG No data
1192235911_1192235922 24 Left 1192235911 X:69296009-69296031 CCTGTTCTCTGTTCCCTCAGCCT No data
Right 1192235922 X:69296056-69296078 ATTCATCAGCGAAGTGTCAGAGG No data
1192235918_1192235922 -5 Left 1192235918 X:69296038-69296060 CCTCCCCACGCTTGTGGAATTCA No data
Right 1192235922 X:69296056-69296078 ATTCATCAGCGAAGTGTCAGAGG No data
1192235914_1192235922 4 Left 1192235914 X:69296029-69296051 CCTCCATGCCCTCCCCACGCTTG No data
Right 1192235922 X:69296056-69296078 ATTCATCAGCGAAGTGTCAGAGG No data
1192235920_1192235922 -9 Left 1192235920 X:69296042-69296064 CCCACGCTTGTGGAATTCATCAG No data
Right 1192235922 X:69296056-69296078 ATTCATCAGCGAAGTGTCAGAGG No data
1192235913_1192235922 10 Left 1192235913 X:69296023-69296045 CCTCAGCCTCCATGCCCTCCCCA No data
Right 1192235922 X:69296056-69296078 ATTCATCAGCGAAGTGTCAGAGG No data
1192235919_1192235922 -8 Left 1192235919 X:69296041-69296063 CCCCACGCTTGTGGAATTCATCA No data
Right 1192235922 X:69296056-69296078 ATTCATCAGCGAAGTGTCAGAGG No data
1192235915_1192235922 1 Left 1192235915 X:69296032-69296054 CCATGCCCTCCCCACGCTTGTGG No data
Right 1192235922 X:69296056-69296078 ATTCATCAGCGAAGTGTCAGAGG No data
1192235912_1192235922 11 Left 1192235912 X:69296022-69296044 CCCTCAGCCTCCATGCCCTCCCC No data
Right 1192235922 X:69296056-69296078 ATTCATCAGCGAAGTGTCAGAGG No data
1192235917_1192235922 -4 Left 1192235917 X:69296037-69296059 CCCTCCCCACGCTTGTGGAATTC No data
Right 1192235922 X:69296056-69296078 ATTCATCAGCGAAGTGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192235922 Original CRISPR ATTCATCAGCGAAGTGTCAG AGG Intergenic