ID: 1192235928

View in Genome Browser
Species Human (GRCh38)
Location X:69296094-69296116
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192235921_1192235928 28 Left 1192235921 X:69296043-69296065 CCACGCTTGTGGAATTCATCAGC No data
Right 1192235928 X:69296094-69296116 CCCTTCAGAGCTTCCCACTGAGG No data
1192235920_1192235928 29 Left 1192235920 X:69296042-69296064 CCCACGCTTGTGGAATTCATCAG No data
Right 1192235928 X:69296094-69296116 CCCTTCAGAGCTTCCCACTGAGG No data
1192235919_1192235928 30 Left 1192235919 X:69296041-69296063 CCCCACGCTTGTGGAATTCATCA No data
Right 1192235928 X:69296094-69296116 CCCTTCAGAGCTTCCCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192235928 Original CRISPR CCCTTCAGAGCTTCCCACTG AGG Intergenic
No off target data available for this crispr