ID: 1192235954

View in Genome Browser
Species Human (GRCh38)
Location X:69296183-69296205
Sequence CAGCTAAGGTGGCGGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192235941_1192235954 10 Left 1192235941 X:69296150-69296172 CCTCAATGCCATCCACCTGATCC No data
Right 1192235954 X:69296183-69296205 CAGCTAAGGTGGCGGCAGAGGGG No data
1192235937_1192235954 22 Left 1192235937 X:69296138-69296160 CCCTTCAGATCCCCTCAATGCCA No data
Right 1192235954 X:69296183-69296205 CAGCTAAGGTGGCGGCAGAGGGG No data
1192235943_1192235954 2 Left 1192235943 X:69296158-69296180 CCATCCACCTGATCCTGAGGTGG No data
Right 1192235954 X:69296183-69296205 CAGCTAAGGTGGCGGCAGAGGGG No data
1192235939_1192235954 12 Left 1192235939 X:69296148-69296170 CCCCTCAATGCCATCCACCTGAT No data
Right 1192235954 X:69296183-69296205 CAGCTAAGGTGGCGGCAGAGGGG No data
1192235947_1192235954 -5 Left 1192235947 X:69296165-69296187 CCTGATCCTGAGGTGGGTCAGCT No data
Right 1192235954 X:69296183-69296205 CAGCTAAGGTGGCGGCAGAGGGG No data
1192235940_1192235954 11 Left 1192235940 X:69296149-69296171 CCCTCAATGCCATCCACCTGATC No data
Right 1192235954 X:69296183-69296205 CAGCTAAGGTGGCGGCAGAGGGG No data
1192235938_1192235954 21 Left 1192235938 X:69296139-69296161 CCTTCAGATCCCCTCAATGCCAT No data
Right 1192235954 X:69296183-69296205 CAGCTAAGGTGGCGGCAGAGGGG No data
1192235946_1192235954 -2 Left 1192235946 X:69296162-69296184 CCACCTGATCCTGAGGTGGGTCA No data
Right 1192235954 X:69296183-69296205 CAGCTAAGGTGGCGGCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192235954 Original CRISPR CAGCTAAGGTGGCGGCAGAG GGG Intergenic
No off target data available for this crispr