ID: 1192236248

View in Genome Browser
Species Human (GRCh38)
Location X:69297952-69297974
Sequence CTGGAGACATATCTGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192236248_1192236255 -4 Left 1192236248 X:69297952-69297974 CCCAGCCCCAGATATGTCTCCAG No data
Right 1192236255 X:69297971-69297993 CCAGCCTGATCTGGCCAATGAGG No data
1192236248_1192236258 18 Left 1192236248 X:69297952-69297974 CCCAGCCCCAGATATGTCTCCAG No data
Right 1192236258 X:69297993-69298015 GCTCTACAGCAGTGCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192236248 Original CRISPR CTGGAGACATATCTGGGGCT GGG (reversed) Intergenic
No off target data available for this crispr