ID: 1192236248 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:69297952-69297974 |
| Sequence | CTGGAGACATATCTGGGGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1192236248_1192236255 | -4 | Left | 1192236248 | X:69297952-69297974 | CCCAGCCCCAGATATGTCTCCAG | No data | ||
| Right | 1192236255 | X:69297971-69297993 | CCAGCCTGATCTGGCCAATGAGG | No data | ||||
| 1192236248_1192236258 | 18 | Left | 1192236248 | X:69297952-69297974 | CCCAGCCCCAGATATGTCTCCAG | No data | ||
| Right | 1192236258 | X:69297993-69298015 | GCTCTACAGCAGTGCCACCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1192236248 | Original CRISPR | CTGGAGACATATCTGGGGCT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||