ID: 1192237552

View in Genome Browser
Species Human (GRCh38)
Location X:69305707-69305729
Sequence GGCAGGCGGCGAGGCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192237552_1192237564 17 Left 1192237552 X:69305707-69305729 CCGGCGCGGCCTCGCCGCCTGCC No data
Right 1192237564 X:69305747-69305769 CCCTCCTCTTCTGCCGGCTGAGG No data
1192237552_1192237561 11 Left 1192237552 X:69305707-69305729 CCGGCGCGGCCTCGCCGCCTGCC No data
Right 1192237561 X:69305741-69305763 TCGAGCCCCTCCTCTTCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192237552 Original CRISPR GGCAGGCGGCGAGGCCGCGC CGG (reversed) Intergenic