ID: 1192238280

View in Genome Browser
Species Human (GRCh38)
Location X:69310014-69310036
Sequence ATGAAAGTCCACCCCAGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192238280_1192238281 22 Left 1192238280 X:69310014-69310036 CCTTTTCTGGGGTGGACTTTCAT No data
Right 1192238281 X:69310059-69310081 TTAATCGCCATTTGAAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192238280 Original CRISPR ATGAAAGTCCACCCCAGAAA AGG (reversed) Intergenic
No off target data available for this crispr