ID: 1192246179

View in Genome Browser
Species Human (GRCh38)
Location X:69373526-69373548
Sequence CATTGTAGCCAGAGTGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192246179_1192246187 23 Left 1192246179 X:69373526-69373548 CCCACTCCACTCTGGCTACAATG No data
Right 1192246187 X:69373572-69373594 ACCAAACTCATTCCCTCCTTAGG No data
1192246179_1192246189 24 Left 1192246179 X:69373526-69373548 CCCACTCCACTCTGGCTACAATG No data
Right 1192246189 X:69373573-69373595 CCAAACTCATTCCCTCCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192246179 Original CRISPR CATTGTAGCCAGAGTGGAGT GGG (reversed) Intergenic
No off target data available for this crispr