ID: 1192250694

View in Genome Browser
Species Human (GRCh38)
Location X:69411170-69411192
Sequence AGGCTTGGGATACAATTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192250694_1192250700 15 Left 1192250694 X:69411170-69411192 CCAATCAATTGTATCCCAAGCCT No data
Right 1192250700 X:69411208-69411230 ACCCACCCAGCCCTGGCTCTTGG No data
1192250694_1192250702 16 Left 1192250694 X:69411170-69411192 CCAATCAATTGTATCCCAAGCCT No data
Right 1192250702 X:69411209-69411231 CCCACCCAGCCCTGGCTCTTGGG No data
1192250694_1192250699 8 Left 1192250694 X:69411170-69411192 CCAATCAATTGTATCCCAAGCCT No data
Right 1192250699 X:69411201-69411223 CTTCTATACCCACCCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192250694 Original CRISPR AGGCTTGGGATACAATTGAT TGG (reversed) Intergenic
No off target data available for this crispr