ID: 1192251386

View in Genome Browser
Species Human (GRCh38)
Location X:69416865-69416887
Sequence GCCGGCTGGCCCGCAAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192251381_1192251386 -4 Left 1192251381 X:69416846-69416868 CCACCCAACACTCGGAGCAGCCG No data
Right 1192251386 X:69416865-69416887 GCCGGCTGGCCCGCAAGCCCCGG No data
1192251375_1192251386 28 Left 1192251375 X:69416814-69416836 CCAGCGCGAGTTCCGGGTGGGCA No data
Right 1192251386 X:69416865-69416887 GCCGGCTGGCCCGCAAGCCCCGG No data
1192251384_1192251386 -8 Left 1192251384 X:69416850-69416872 CCAACACTCGGAGCAGCCGGCTG No data
Right 1192251386 X:69416865-69416887 GCCGGCTGGCCCGCAAGCCCCGG No data
1192251383_1192251386 -7 Left 1192251383 X:69416849-69416871 CCCAACACTCGGAGCAGCCGGCT No data
Right 1192251386 X:69416865-69416887 GCCGGCTGGCCCGCAAGCCCCGG No data
1192251379_1192251386 16 Left 1192251379 X:69416826-69416848 CCGGGTGGGCATGGGCTTGGCCA No data
Right 1192251386 X:69416865-69416887 GCCGGCTGGCCCGCAAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192251386 Original CRISPR GCCGGCTGGCCCGCAAGCCC CGG Intergenic
No off target data available for this crispr