ID: 1192251930

View in Genome Browser
Species Human (GRCh38)
Location X:69421054-69421076
Sequence GGCAAACCCCTAAGTGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192251930_1192251931 -7 Left 1192251930 X:69421054-69421076 CCTTGATCACTTAGGGGTTTGCC No data
Right 1192251931 X:69421070-69421092 GTTTGCCATTCAAGTACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192251930 Original CRISPR GGCAAACCCCTAAGTGATCA AGG (reversed) Intergenic
No off target data available for this crispr