ID: 1192251931

View in Genome Browser
Species Human (GRCh38)
Location X:69421070-69421092
Sequence GTTTGCCATTCAAGTACTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192251926_1192251931 11 Left 1192251926 X:69421036-69421058 CCAAGTTTTTCTGTATGTCCTTG No data
Right 1192251931 X:69421070-69421092 GTTTGCCATTCAAGTACTGCAGG No data
1192251930_1192251931 -7 Left 1192251930 X:69421054-69421076 CCTTGATCACTTAGGGGTTTGCC No data
Right 1192251931 X:69421070-69421092 GTTTGCCATTCAAGTACTGCAGG No data
1192251925_1192251931 12 Left 1192251925 X:69421035-69421057 CCCAAGTTTTTCTGTATGTCCTT No data
Right 1192251931 X:69421070-69421092 GTTTGCCATTCAAGTACTGCAGG No data
1192251923_1192251931 21 Left 1192251923 X:69421026-69421048 CCTGTAAGCCCCAAGTTTTTCTG No data
Right 1192251931 X:69421070-69421092 GTTTGCCATTCAAGTACTGCAGG No data
1192251924_1192251931 13 Left 1192251924 X:69421034-69421056 CCCCAAGTTTTTCTGTATGTCCT No data
Right 1192251931 X:69421070-69421092 GTTTGCCATTCAAGTACTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192251931 Original CRISPR GTTTGCCATTCAAGTACTGC AGG Intergenic
No off target data available for this crispr