ID: 1192252710

View in Genome Browser
Species Human (GRCh38)
Location X:69426101-69426123
Sequence TAGGCTCAGGCTACTGTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192252710_1192252715 3 Left 1192252710 X:69426101-69426123 CCACGGACAGTAGCCTGAGCCTA No data
Right 1192252715 X:69426127-69426149 ATATGCATAATAGTTCACAGGGG No data
1192252710_1192252713 1 Left 1192252710 X:69426101-69426123 CCACGGACAGTAGCCTGAGCCTA No data
Right 1192252713 X:69426125-69426147 TCATATGCATAATAGTTCACAGG No data
1192252710_1192252717 26 Left 1192252710 X:69426101-69426123 CCACGGACAGTAGCCTGAGCCTA No data
Right 1192252717 X:69426150-69426172 TCACCAGGCCTGTGAACACAAGG No data
1192252710_1192252716 11 Left 1192252710 X:69426101-69426123 CCACGGACAGTAGCCTGAGCCTA No data
Right 1192252716 X:69426135-69426157 AATAGTTCACAGGGGTCACCAGG No data
1192252710_1192252714 2 Left 1192252710 X:69426101-69426123 CCACGGACAGTAGCCTGAGCCTA No data
Right 1192252714 X:69426126-69426148 CATATGCATAATAGTTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192252710 Original CRISPR TAGGCTCAGGCTACTGTCCG TGG (reversed) Intergenic
No off target data available for this crispr