ID: 1192254293

View in Genome Browser
Species Human (GRCh38)
Location X:69442822-69442844
Sequence CAGCAGAAACCCTCCATCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192254293_1192254298 -6 Left 1192254293 X:69442822-69442844 CCCAAGATGGAGGGTTTCTGCTG No data
Right 1192254298 X:69442839-69442861 CTGCTGTGGCCACAAGCCAGGGG No data
1192254293_1192254307 30 Left 1192254293 X:69442822-69442844 CCCAAGATGGAGGGTTTCTGCTG No data
Right 1192254307 X:69442875-69442897 GATGAGCTCTGAGGGGTGTGTGG No data
1192254293_1192254296 -8 Left 1192254293 X:69442822-69442844 CCCAAGATGGAGGGTTTCTGCTG No data
Right 1192254296 X:69442837-69442859 TTCTGCTGTGGCCACAAGCCAGG No data
1192254293_1192254305 22 Left 1192254293 X:69442822-69442844 CCCAAGATGGAGGGTTTCTGCTG No data
Right 1192254305 X:69442867-69442889 TGTCTGGTGATGAGCTCTGAGGG No data
1192254293_1192254300 6 Left 1192254293 X:69442822-69442844 CCCAAGATGGAGGGTTTCTGCTG No data
Right 1192254300 X:69442851-69442873 CAAGCCAGGGGTTCCCTGTCTGG 0: 16
1: 33
2: 47
3: 46
4: 186
1192254293_1192254297 -7 Left 1192254293 X:69442822-69442844 CCCAAGATGGAGGGTTTCTGCTG No data
Right 1192254297 X:69442838-69442860 TCTGCTGTGGCCACAAGCCAGGG No data
1192254293_1192254306 23 Left 1192254293 X:69442822-69442844 CCCAAGATGGAGGGTTTCTGCTG No data
Right 1192254306 X:69442868-69442890 GTCTGGTGATGAGCTCTGAGGGG No data
1192254293_1192254304 21 Left 1192254293 X:69442822-69442844 CCCAAGATGGAGGGTTTCTGCTG No data
Right 1192254304 X:69442866-69442888 CTGTCTGGTGATGAGCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192254293 Original CRISPR CAGCAGAAACCCTCCATCTT GGG (reversed) Intergenic
No off target data available for this crispr