ID: 1192254299

View in Genome Browser
Species Human (GRCh38)
Location X:69442848-69442870
Sequence GACAGGGAACCCCTGGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192254299_1192254304 -5 Left 1192254299 X:69442848-69442870 CCACAAGCCAGGGGTTCCCTGTC No data
Right 1192254304 X:69442866-69442888 CTGTCTGGTGATGAGCTCTGAGG No data
1192254299_1192254306 -3 Left 1192254299 X:69442848-69442870 CCACAAGCCAGGGGTTCCCTGTC No data
Right 1192254306 X:69442868-69442890 GTCTGGTGATGAGCTCTGAGGGG No data
1192254299_1192254308 5 Left 1192254299 X:69442848-69442870 CCACAAGCCAGGGGTTCCCTGTC No data
Right 1192254308 X:69442876-69442898 ATGAGCTCTGAGGGGTGTGTGGG No data
1192254299_1192254307 4 Left 1192254299 X:69442848-69442870 CCACAAGCCAGGGGTTCCCTGTC No data
Right 1192254307 X:69442875-69442897 GATGAGCTCTGAGGGGTGTGTGG No data
1192254299_1192254310 14 Left 1192254299 X:69442848-69442870 CCACAAGCCAGGGGTTCCCTGTC No data
Right 1192254310 X:69442885-69442907 GAGGGGTGTGTGGGACCCATGGG No data
1192254299_1192254309 13 Left 1192254299 X:69442848-69442870 CCACAAGCCAGGGGTTCCCTGTC No data
Right 1192254309 X:69442884-69442906 TGAGGGGTGTGTGGGACCCATGG No data
1192254299_1192254305 -4 Left 1192254299 X:69442848-69442870 CCACAAGCCAGGGGTTCCCTGTC No data
Right 1192254305 X:69442867-69442889 TGTCTGGTGATGAGCTCTGAGGG No data
1192254299_1192254311 25 Left 1192254299 X:69442848-69442870 CCACAAGCCAGGGGTTCCCTGTC No data
Right 1192254311 X:69442896-69442918 GGGACCCATGGGAGACAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192254299 Original CRISPR GACAGGGAACCCCTGGCTTG TGG (reversed) Intergenic
No off target data available for this crispr