ID: 1192254301

View in Genome Browser
Species Human (GRCh38)
Location X:69442855-69442877
Sequence ATCACCAGACAGGGAACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 320
Summary {0: 11, 1: 34, 2: 35, 3: 51, 4: 189}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192254301_1192254307 -3 Left 1192254301 X:69442855-69442877 CCAGGGGTTCCCTGTCTGGTGAT 0: 11
1: 34
2: 35
3: 51
4: 189
Right 1192254307 X:69442875-69442897 GATGAGCTCTGAGGGGTGTGTGG No data
1192254301_1192254311 18 Left 1192254301 X:69442855-69442877 CCAGGGGTTCCCTGTCTGGTGAT 0: 11
1: 34
2: 35
3: 51
4: 189
Right 1192254311 X:69442896-69442918 GGGACCCATGGGAGACAGACTGG No data
1192254301_1192254310 7 Left 1192254301 X:69442855-69442877 CCAGGGGTTCCCTGTCTGGTGAT 0: 11
1: 34
2: 35
3: 51
4: 189
Right 1192254310 X:69442885-69442907 GAGGGGTGTGTGGGACCCATGGG No data
1192254301_1192254306 -10 Left 1192254301 X:69442855-69442877 CCAGGGGTTCCCTGTCTGGTGAT 0: 11
1: 34
2: 35
3: 51
4: 189
Right 1192254306 X:69442868-69442890 GTCTGGTGATGAGCTCTGAGGGG No data
1192254301_1192254308 -2 Left 1192254301 X:69442855-69442877 CCAGGGGTTCCCTGTCTGGTGAT 0: 11
1: 34
2: 35
3: 51
4: 189
Right 1192254308 X:69442876-69442898 ATGAGCTCTGAGGGGTGTGTGGG No data
1192254301_1192254309 6 Left 1192254301 X:69442855-69442877 CCAGGGGTTCCCTGTCTGGTGAT 0: 11
1: 34
2: 35
3: 51
4: 189
Right 1192254309 X:69442884-69442906 TGAGGGGTGTGTGGGACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192254301 Original CRISPR ATCACCAGACAGGGAACCCC TGG (reversed) Intergenic
901009824 1:6193902-6193924 AACACTAGACAGGAAACCCAAGG + Intronic
901627132 1:10630765-10630787 ATGAGCAGACAGGGAGCCACAGG - Intergenic
903345590 1:22682233-22682255 ACCACCAGCCAAGGAACACCGGG - Intergenic
903946763 1:26968917-26968939 GGCACAAGACAGAGAACCCCAGG - Intergenic
912639413 1:111330857-111330879 ATCACCAGACAAGGAACCCCTGG - Intergenic
913372960 1:118121090-118121112 AACTCCAGGCAGGGAAGCCCAGG - Intronic
913608924 1:120492046-120492068 ATCAACAGAAAGGGAACTTCTGG - Intergenic
914204907 1:145518405-145518427 ATCAACAGAAAGGGAACTTCTGG + Intergenic
914582269 1:149029792-149029814 ATCAACAGAAAGGGAACTTCTGG + Exonic
917149367 1:171928513-171928535 ATCACCAGACAGGGAACCCCTGG - Intronic
917173261 1:172201539-172201561 ATCACCACACAGGGAACCCCTGG - Intronic
917259043 1:173147851-173147873 CTCACCAGACAGGGAACCCCTGG - Intergenic
919578038 1:199336700-199336722 GTCACCAGACTGAGAACCCGTGG + Intergenic
920786978 1:209051172-209051194 ATCACTAGACAGGGAACCCCTGG + Intergenic
921012935 1:211161106-211161128 ATCACCAGACAGGGAACCCCTGG - Intergenic
924780260 1:247141136-247141158 GTCACCAGATAGGAAACCCTGGG - Intronic
924814972 1:247433501-247433523 ATCACCTGTCAGTGAACTCCCGG - Intronic
924919524 1:248613068-248613090 ATCACCAGGAAGGGCCCCCCTGG + Intergenic
1066681235 10:37938392-37938414 AGCACCAGCCAGGGGACCCCAGG + Intergenic
1072447679 10:95513695-95513717 TTCACCAGACATGGGACACCTGG + Intronic
1073473893 10:103740512-103740534 ATCACCAGACACAGTACCACTGG + Intronic
1073875929 10:107921069-107921091 GTCACCAGACAGGGATCCTGTGG + Intergenic
1074942575 10:118249371-118249393 ATCACCAAGCAGAGAACCCTGGG + Intergenic
1075893799 10:125977740-125977762 ATCACCAGACAGGGAACCCCTGG - Intronic
1076488188 10:130837685-130837707 GTCACCAGCCAAGGAACTCCTGG + Intergenic
1077755825 11:5026107-5026129 ATCACTAGGCAGGGAGTCCCTGG + Intergenic
1078294860 11:10057479-10057501 GTCATCAGACAGGGAACCCCTGG + Intronic
1078598629 11:12711512-12711534 TTCACCAGCCAGGGACCCCTGGG - Intronic
1078992565 11:16664703-16664725 ACCACCAGCCAGGGAAGCCAAGG + Intronic
1079668322 11:23135138-23135160 GTCACCAGACAGGGAACCCCTGG - Intergenic
1081643398 11:44773783-44773805 AAGACCAGCCTGGGAACCCCTGG + Intronic
1083008220 11:59368584-59368606 ATCACCAGACAAAGAACCCCTGG + Intergenic
1084254612 11:67931762-67931784 ATCACCAAGCAGGGAACAGCGGG + Intergenic
1084463664 11:69309781-69309803 AGCAGCAGACAGGGGACCTCTGG - Intronic
1084818262 11:71664125-71664147 ATCACCAAGCAGGGAACAGCGGG - Intergenic
1085706257 11:78789052-78789074 ATCATCAGACTAGGAACCCGAGG + Intronic
1086448564 11:86893123-86893145 AACACCAGCCAGGGAATGCCAGG + Intronic
1087399815 11:97651475-97651497 ATCACCAGACAGGGAATCCCTGG - Intergenic
1088685896 11:112284436-112284458 ATCTTCAGATATGGAACCCCAGG + Intergenic
1088878884 11:113958105-113958127 ATCACCAGAAAGGGAAGATCAGG - Intergenic
1089466523 11:118689680-118689702 ATCACCCTACAGGAAACTCCTGG - Intergenic
1090137004 11:124209548-124209570 CTCAGCAGACAGGAAACCCTGGG + Intergenic
1092534992 12:9379120-9379142 CACACCAGGCAGGGCACCCCAGG + Intergenic
1092579367 12:9821481-9821503 ATCACCAAGCAGAGAAACCCTGG + Intergenic
1093240073 12:16659260-16659282 ATCACCAGGCAGGGAACCTCTGG - Intergenic
1095042366 12:37456308-37456330 CTCAGCAGAAAGGGAAACCCTGG - Intergenic
1095824277 12:46515749-46515771 GTCACCAGACAGGGAATCTCTGG - Intergenic
1096783334 12:54003371-54003393 AACAGCAGACTGGGAACCACAGG - Intronic
1098566873 12:71946895-71946917 ATCACCAGAAATAGAATCCCAGG - Intronic
1099184922 12:79505648-79505670 ATCACCAGATAGGAAATCCCTGG + Intergenic
1099860375 12:88218452-88218474 ATCACCAGGCAGGGACCCCATGG + Intergenic
1100135158 12:91545042-91545064 GTCACCAGAAAGGAAACTCCTGG + Intergenic
1102033528 12:109758436-109758458 GTGACCAGCCAGGGAACCTCAGG - Intronic
1102476487 12:113191887-113191909 TTCATCACCCAGGGAACCCCAGG + Exonic
1104933231 12:132351494-132351516 ATCACCAGAAAGTGGACCCTCGG + Intergenic
1105069855 12:133227777-133227799 GGCACCAGGCAGGGACCCCCTGG + Intronic
1109593694 13:64522429-64522451 ATCACCAGCCAGGGGTCCCCAGG - Intergenic
1110035000 13:70672445-70672467 GTAACCAGACAGGGAACTCCTGG - Intergenic
1113233487 13:108241749-108241771 ATCACGAGACAAGGAAGCCGAGG + Intergenic
1113660997 13:112106127-112106149 ATCACCAGCCAGGGCAGCTCCGG - Intergenic
1114819758 14:26004471-26004493 CTCACCACACTGGGAACCACAGG + Intergenic
1117003276 14:51393459-51393481 ACCACCAGTGATGGAACCCCAGG - Intergenic
1118879147 14:69811340-69811362 CTGACCAGACAGGGTACTCCAGG - Intergenic
1118957692 14:70497729-70497751 ATCAACAGACAGGGAACCCCTGG + Intergenic
1119031431 14:71195884-71195906 ATCACCAGCCAGGGAAACAGGGG - Intergenic
1121239439 14:92418204-92418226 CTCAACAGACAGGGAAGCCTGGG + Intronic
1122842477 14:104473181-104473203 ATCCCCAGACCGGGCACTCCGGG - Intergenic
1123141484 14:106083355-106083377 ATCACCAAAATGGAAACCCCTGG + Intergenic
1123695596 15:22877009-22877031 ATGACCAGACAGGCATCCTCAGG + Intronic
1125506934 15:40272483-40272505 CTCACCAGCCAGGGCACCCTTGG - Exonic
1126225183 15:46261953-46261975 GTCACCAGACAGGGAACCCCTGG - Intergenic
1126292571 15:47099213-47099235 CTCAGCAGAAAGGGAAGCCCTGG + Intergenic
1127188584 15:56506258-56506280 ATCACCACACAGGGAACCTGTGG + Intergenic
1130086549 15:80782340-80782362 ATGACCACTCAGTGAACCCCTGG - Intronic
1130263442 15:82377713-82377735 ATCTCCAGTCAGGAAACCTCTGG + Intergenic
1130277859 15:82491945-82491967 ATCTCCAGTCAGGAAACCTCTGG - Intergenic
1130470188 15:84219130-84219152 ATCTCCAGTCAGGAAACCTCTGG - Intergenic
1130477676 15:84333697-84333719 ATCTCCAGTCAGGAAACCTCTGG - Intergenic
1130494089 15:84454433-84454455 ATCTCCAGTCAGGAAACCTCTGG + Intergenic
1130592477 15:85223758-85223780 ATCTCCAGTCAGGAAACCTCTGG - Intergenic
1131333164 15:91521423-91521445 GTCACCTGACAATGAACCCCAGG - Intergenic
1132925427 16:2426862-2426884 ATCAACAGACAGGGGAGCCAGGG + Intergenic
1133223770 16:4330495-4330517 ATCGCAAGCCAGGGAGCCCCAGG - Intronic
1133839229 16:9393842-9393864 CTCACCAGCCTGGGAGCCCCAGG - Intergenic
1134009429 16:10840624-10840646 ATCCCCAGGCAGAGAACCCAAGG - Intergenic
1134244545 16:12530302-12530324 ACCAACAGACAGGGAGCCTCGGG + Intronic
1136317543 16:29463291-29463313 ATCACCACACAGCCCACCCCAGG - Intronic
1136432118 16:30202636-30202658 ATCACCACACAGCCCACCCCAGG - Intronic
1141332603 16:83125807-83125829 ATCACCAGATAGGGCCCCCTAGG + Intronic
1141959953 16:87398960-87398982 ATCACCAGACAGCCAAACCCTGG + Intronic
1142008658 16:87702406-87702428 ACCCCCAGCCTGGGAACCCCCGG + Intronic
1142108528 16:88318989-88319011 AGGACCAGACGGGGCACCCCAGG + Intergenic
1144453822 17:15402974-15402996 TTACCAAGACAGGGAACCCCAGG + Intergenic
1144555832 17:16282124-16282146 ATCACCAGACAGGGTCTTCCTGG + Intronic
1148135256 17:45287881-45287903 AACAGCAGCCAGGGACCCCCAGG - Intronic
1148208339 17:45793451-45793473 AGCACCAGGGAGGGAACCCCAGG - Intronic
1148693843 17:49547639-49547661 ATCAGCAGAGAGGGGACCTCAGG + Intergenic
1149317259 17:55450178-55450200 ATCACAAGCCAAGGAACTCCTGG + Intergenic
1152514407 17:80814854-80814876 AGCCCCAAGCAGGGAACCCCTGG + Intronic
1153785418 18:8529520-8529542 GTCACCAGACAGGAAACCCCTGG + Intergenic
1154181328 18:12142324-12142346 ACTACCAGACAGGGAACCCCCGG - Intergenic
1154182576 18:12149260-12149282 ACTACCAGACAGGGAACCCCCGG + Intergenic
1157847172 18:51014717-51014739 AGCACGAGACAATGAACCCCAGG + Intronic
1158443642 18:57500003-57500025 ACCTCCAGAAAGGGATCCCCAGG + Intergenic
1159607073 18:70485707-70485729 GTCCCCATGCAGGGAACCCCTGG - Intergenic
1159966603 18:74601142-74601164 ATCACCACACAGGGAACACCAGG - Intronic
1160349744 18:78166671-78166693 AGCACCATCCAGGGACCCCCCGG + Intergenic
1160546165 18:79657382-79657404 ATGACCAGACAGGGCCGCCCTGG + Intergenic
1163237149 19:16036536-16036558 ATGACCACGCAGGGAACCCATGG - Intergenic
1166677978 19:44750911-44750933 ATCACCTAGCAGGGGACCCCAGG - Intronic
1166911662 19:46163451-46163473 ATCACCAGGCAGGGAACCCCTGG - Intergenic
925646978 2:6045391-6045413 GTCACCAGAAAGGGAACCCCTGG + Intergenic
927705786 2:25295592-25295614 ATTAACTGACAGAGAACCCCTGG + Intronic
929888341 2:45898559-45898581 ATAACCAGATAGGAAAGCCCAGG - Intronic
929936910 2:46299436-46299458 TTCAAAAGACATGGAACCCCAGG - Intronic
930275538 2:49306391-49306413 ATCACAAGACAGAGAAGCTCAGG - Intergenic
930304789 2:49665075-49665097 ATCACTAGGCAGGGAACCCCTGG - Intergenic
931543422 2:63354195-63354217 GTCACCAGACAAGGAACCCCTGG + Intronic
931626307 2:64259121-64259143 ATCAGCAGGCTGGGAACCCTTGG + Intergenic
932234483 2:70110015-70110037 AGCAGGAGACAGGGCACCCCAGG + Intergenic
933085718 2:78052523-78052545 ATCACCAGACTGGGGACCCCTGG - Intergenic
934623191 2:95828894-95828916 CATAACAGACAGGGAACCCCTGG - Intergenic
935834697 2:107037526-107037548 GTCACAGGACAGGGAACCCCTGG + Intergenic
937521036 2:122712418-122712440 ATTACCAGACTGGGAACCCCTGG + Intergenic
937569075 2:123334219-123334241 ATCACTAGACTGGGAACCCCTGG + Intergenic
939641368 2:144643657-144643679 ATCCCCACACAGAGAACCCCTGG - Intergenic
940674697 2:156714170-156714192 ATCACCAGACAGGGAATGCCTGG - Intergenic
940737978 2:157474756-157474778 ATCACAAGACAGAGAAGCTCAGG + Intronic
941096391 2:161243307-161243329 ATCTCCAGACAGTGAAGGCCAGG - Intergenic
943611869 2:190044365-190044387 ATCACCAGGCAGTAAACTCCTGG - Intronic
945016268 2:205520258-205520280 ATCACCAGACAAGGAATCCCTGG - Intronic
946141415 2:217694027-217694049 ATCACCAGAAAGAGAAACACAGG + Intronic
948268702 2:236657370-236657392 ATCACCACACAGGCAAAACCTGG - Intergenic
948927122 2:241106573-241106595 GTCAGCAGACGGGGATCCCCGGG + Exonic
1170745551 20:19095537-19095559 ATATACAGCCAGGGAACCCCTGG - Intergenic
1171536799 20:25899380-25899402 CTCAGCAGAAAGGGAATCCCTGG - Intergenic
1171804312 20:29661777-29661799 CTCAGCAGAAAGGGAAGCCCTGG + Intergenic
1171839740 20:30194645-30194667 CTCAGCAGAAAGGGAAGCCCTGG - Intergenic
1172297822 20:33826065-33826087 CTCACCAGACAGGGAGTTCCTGG - Intronic
1173116155 20:40245094-40245116 CTCACCAGACACTGAACCTCTGG - Intergenic
1173460879 20:43242621-43242643 AGCACCAGGCAGGGGACCCAGGG + Intergenic
1175163095 20:57023296-57023318 ATCACCAGACAGGCCTCTCCTGG + Intergenic
1175773034 20:61635643-61635665 ACCACCAGAGAGGGCATCCCAGG + Intronic
1176013443 20:62913389-62913411 TTCACCAGCCAGGTGACCCCAGG + Intronic
1176582266 21:8542909-8542931 CTCAGCAGAAAGGGAAACCCTGG + Intergenic
1178229205 21:30761736-30761758 ATCACCAGAGTGAGAACTCCAGG - Intergenic
1179479037 21:41666180-41666202 AACACCAGCCAGCAAACCCCAGG - Intergenic
1180265101 22:10519957-10519979 CTCAGCAGAAAGGGAAACCCTGG + Intergenic
1181501137 22:23316195-23316217 ACCCCCAGGGAGGGAACCCCAGG + Exonic
1181519744 22:23438373-23438395 CTCAGCAAACAGGGAAGCCCTGG - Intergenic
1181651016 22:24259223-24259245 ACCCCCAGGGAGGGAACCCCAGG - Intergenic
1183041749 22:35185064-35185086 ATCACCACACAGGGAACCCCTGG + Intergenic
1183485123 22:38084362-38084384 AGCACCAGACTAGGACCCCCTGG - Intergenic
1184645451 22:45892455-45892477 CTGCCCAGACAGGGAAGCCCGGG - Intergenic
1184886181 22:47345633-47345655 GTCACCAGCCAAGGAACCCCTGG - Intergenic
1184890336 22:47375294-47375316 GGCACCTGGCAGGGAACCCCTGG + Intergenic
1203215843 22_KI270731v1_random:5380-5402 ACCCCCAGGGAGGGAACCCCAGG + Intergenic
1203274782 22_KI270734v1_random:80011-80033 ACCCCCAGGGAGGGAACCCCAGG - Intergenic
951197092 3:19836359-19836381 ATCACCAGACAGGGAACCCCTGG + Intergenic
951283442 3:20780174-20780196 GTCATCAGACAGGGAACATCTGG + Intergenic
953167863 3:40481635-40481657 ATCACCAGGCAGAGAACAACAGG + Intronic
953250854 3:41244830-41244852 TTCCCCAGACAGGCAACACCGGG + Intronic
953611460 3:44450772-44450794 ATTACTAGACAGAGAAACCCAGG + Intronic
954498692 3:50989125-50989147 GTCACCAGACAGGAAACCCCTGG + Intronic
957070110 3:75561129-75561151 ATCATCAGACTGGGAGTCCCTGG + Intergenic
957282552 3:78172303-78172325 AACTCCAGAAAGGGAAGCCCTGG - Intergenic
959452190 3:106517634-106517656 ATCACCATACAAGAAACCCCTGG + Intergenic
960685302 3:120288509-120288531 CTCACTGGACAGGCAACCCCTGG + Intergenic
962750833 3:138434026-138434048 ATCATCAGACGGGGAACTTCCGG - Intergenic
962997674 3:140647619-140647641 ATCACAAGACAGGAAACCCCTGG - Intergenic
965317841 3:167212560-167212582 GTTACCAGACAAGGAACCCCTGG + Intergenic
965607184 3:170509144-170509166 ATCACCTGTCAGGGAAGCCCAGG + Intronic
966000505 3:174943707-174943729 ATCACCAAATAGGGAACCCCTGG - Intronic
966340991 3:178924545-178924567 ATCACCAGACAGGGAATCCCTGG + Intergenic
967503021 3:190222255-190222277 GTCACCAGACAAGGAAGCCCTGG - Intergenic
969455369 4:7297117-7297139 ATGCCCAGAGAGGGAACCCATGG - Intronic
970610850 4:17723897-17723919 TCCAGCAGACAGGGAACCACAGG - Intronic
970678851 4:18484263-18484285 ATCACTAGACAGAAAACCCTCGG + Intergenic
971003865 4:22352128-22352150 ATAACCAGACAAGGAACCCTTGG + Intronic
975022157 4:69502888-69502910 GTCACAAAACAGGGAACCCCTGG + Intronic
975106143 4:70571370-70571392 GTCACCAGACAGGGAATGCCTGG - Intergenic
975276291 4:72505710-72505732 ATCTCCAGGCAGGGAACTCAGGG - Intronic
976954635 4:90880394-90880416 ATCACCAGACAGGGAACCTCTGG - Intronic
977006241 4:91571819-91571841 ATCACCAGACAAGGAACCTCTGG - Intronic
977819883 4:101458906-101458928 ATCACCAGACAAGGAACCCCTGG + Intronic
978043078 4:104093165-104093187 ATCACAAAACAGGGAACACCTGG + Intergenic
978208270 4:106105226-106105248 ATCACCAGACAGGAAACTCCTGG + Intronic
978399414 4:108314887-108314909 ATCCCCAGACAGGAATACCCTGG - Intergenic
979013073 4:115396037-115396059 ATTACCAGAAAGGGAACCCCTGG - Intergenic
979045075 4:115852301-115852323 ATCACTACACATGGAACTCCTGG + Intergenic
979106441 4:116694966-116694988 ATCACCAGAAAAGGACCTCCAGG + Intergenic
980133896 4:128842179-128842201 ATCCCTAGACAGGGAACCTCAGG - Intronic
985615411 5:917105-917127 AGCACCAGATGGGGAAGCCCAGG - Exonic
987431902 5:17845031-17845053 GTCACCATATAGGGAACCCCTGG - Intergenic
987887618 5:23831628-23831650 ATCACAAGAAAGGGAATCCATGG + Intergenic
988128519 5:27073819-27073841 ATCACCAGACAAGGAGCCCCTGG + Intronic
988936041 5:36083653-36083675 ATCTTAAGACAGGGAACCCCTGG + Intergenic
989218130 5:38926289-38926311 ATCACCAGTCAGGGCACTCCAGG - Intronic
989370357 5:40700530-40700552 GTCACCAGACAGGGAACCCCTGG + Intergenic
989693325 5:44170890-44170912 GTCACCAGACAGGGAACTCTTGG + Intergenic
990470742 5:56113006-56113028 ACCACCAGAGAGAGAGCCCCAGG + Intronic
992782848 5:80143659-80143681 ATCATCACACAGAGAACTCCCGG + Exonic
993018708 5:82564793-82564815 GTCACCAGGCAGGGAACCCCTGG + Intergenic
993176757 5:84496470-84496492 GCCACGAGACAGGGAACCACGGG - Intergenic
993351232 5:86853075-86853097 ATCACCAGACAGGGAACCCCTGG - Intergenic
994242729 5:97443952-97443974 CTCACCAGACAAGGAACCCCTGG - Intergenic
994473385 5:100238276-100238298 ATCACCAGACAGGGAACCCCTGG - Intergenic
995187863 5:109290420-109290442 GTCATCAGATAGGGAACCCCTGG + Intergenic
995396000 5:111687684-111687706 ATCCACAGACAGGGAACTCGTGG - Intronic
995428703 5:112050745-112050767 ATCACCAGACAGCGAACCCCTGG + Intergenic
999074547 5:148781701-148781723 ATCACCAGACAGGGAGCCCCTGG + Intergenic
999790153 5:154932133-154932155 TTCACCAGGCAGGGGACACCAGG + Exonic
1000031717 5:157407301-157407323 GTCACCAGACAGGGAACCCATGG + Intronic
1002394364 5:178941582-178941604 ATCACCTGAGAGGAAACCCTGGG - Intronic
1002525551 5:179813856-179813878 ATCCCCAGACATGGCACCACAGG + Intronic
1003516598 6:6823740-6823762 ACCACCAGACAGGGAAGTCTTGG + Intergenic
1007548356 6:42710408-42710430 GTCACCAGCCTGGGAACTCCTGG + Intronic
1008173263 6:48234842-48234864 ATCACCAGAGAGGGAACCCCTGG + Intergenic
1008211483 6:48729766-48729788 ATCACCAGACAGGGAACCCCTGG + Intergenic
1008687420 6:53941283-53941305 ATTCCCAGCCAGGGAACCCCAGG - Intronic
1008973862 6:57401777-57401799 ATCACCAGACAGAGAACCCCTGG - Intronic
1009162752 6:60303282-60303304 ATCACCAGACAGAGAACCCCTGG - Intergenic
1009325803 6:62346393-62346415 GTCACCAGACAGAGAACTCCTGG + Intergenic
1011392373 6:86867966-86867988 ATCACAAGACAGGGAACCTCTGG + Intergenic
1012616451 6:101284294-101284316 ATCACCAGACAGGGAACACCTGG + Intergenic
1015197318 6:130537525-130537547 GTCACCAGATAGGGAACTCCTGG + Intergenic
1015494337 6:133865111-133865133 ATCACTAGACAAGGAACCCCTGG - Intergenic
1016263749 6:142207282-142207304 ATCTCCTGCCAGGGAACCCAAGG - Intronic
1016288915 6:142506555-142506577 ATCACCAGACAAGGAACCCTTGG - Intergenic
1017535953 6:155348597-155348619 ATCATCAGACAGGAAACCCTGGG - Intergenic
1019004636 6:168786023-168786045 ATCACCAGACGATGAATCCCAGG + Intergenic
1019336550 7:485542-485564 ATCAGGAGGCAGAGAACCCCTGG - Intergenic
1019591518 7:1837899-1837921 CTCAGCAAACAGGGAAGCCCTGG + Intronic
1020702368 7:11499209-11499231 GTCACCAGACAGGGAACTCCTGG + Intronic
1021308384 7:19060458-19060480 ATCACAAGCCAGGGAACTCTTGG + Intronic
1023241304 7:38150935-38150957 GTCACTGGACAAGGAACCCCTGG + Intergenic
1023944331 7:44791827-44791849 ATCAGCAGACACAGAACCTCAGG - Intergenic
1024165465 7:46724945-46724967 ATCACCAGACAGGGAACCCCTGG + Intronic
1025288265 7:57686087-57686109 CTCAGCAGAAAGGGAAACCCTGG - Intergenic
1026963488 7:74424650-74424672 AGCCCCACACAGGGAACTCCCGG + Intergenic
1027251408 7:76400933-76400955 AGCCTCAGACAGGGAACCACAGG - Intronic
1027627589 7:80564470-80564492 GTCACCAGAGAGGGAACCCCTGG - Intronic
1028176922 7:87671143-87671165 GTGACTAGACAGGGAACCCTTGG - Intronic
1029508510 7:100977892-100977914 ATCACAAGCCAAGGAACACCAGG - Intronic
1030200870 7:106902232-106902254 GACACAAGACAGGAAACCCCTGG - Intronic
1030809372 7:113956059-113956081 GTTACCAGACAGGGAACTCCTGG - Intronic
1031074915 7:117202655-117202677 ATCAACAGACAGGGAACAGATGG - Intronic
1031627089 7:124004317-124004339 ATCACCAGACAGGGAAACCCTGG - Intergenic
1034364320 7:150533530-150533552 ATCACCAGACAGGGAATCCCTGG - Intergenic
1035272254 7:157727387-157727409 AGCACAACACAGGGAACCCTGGG + Intronic
1035563492 8:626524-626546 AGCACCAGACAGAGCTCCCCGGG + Intronic
1036710887 8:11077858-11077880 ATCATCAGACCGGGGACCCAGGG + Intronic
1036793611 8:11740079-11740101 ATCCCCAGCCAGGGCTCCCCTGG + Intronic
1038233535 8:25728956-25728978 AGCACCAGACAGGGAACCCCTGG - Intergenic
1040092253 8:43410187-43410209 AGAACCGGACAGGGATCCCCAGG - Intergenic
1041455381 8:58053260-58053282 ACCACCTGACAGCCAACCCCTGG - Intronic
1041476297 8:58271057-58271079 ATCATCAGAGAGGGGATCCCTGG - Intergenic
1041561840 8:59226756-59226778 ATCACCAGAAAGCGAACCCCTGG + Intergenic
1042245153 8:66702536-66702558 ATCACCAGCCATGTAATCCCAGG - Intronic
1042479556 8:69287962-69287984 GTCACAAGCCAAGGAACCCCAGG - Intergenic
1042619896 8:70693718-70693740 GTCACCAGACAGAAAACCCCTGG - Intronic
1042710892 8:71716110-71716132 AGCACCAGACAAGGAACCTCGGG - Intergenic
1043227415 8:77749109-77749131 ATCATCAGACAAGGAACCCTTGG + Intergenic
1043229836 8:77788070-77788092 ATCACCAAACAGGGAACCCCTGG - Intergenic
1043280950 8:78465687-78465709 TTCACCAGACAGGGCACACCTGG + Intergenic
1044162492 8:88936314-88936336 ATCACCAGACAGGGAACCCCTGG + Intergenic
1045426252 8:102068538-102068560 ATCCCCAGAAAGGCCACCCCTGG + Intronic
1045658746 8:104413964-104413986 ATCACCAGATATGGATTCCCAGG - Intronic
1051726270 9:20090157-20090179 ATTACCAGGGAGGGAACCCCTGG + Intergenic
1051827312 9:21234406-21234428 ATCACCAGGCAGGGAACCCCTGG + Intronic
1051899686 9:22025232-22025254 GTCACCAGACAGAGAGCCCCTGG - Intronic
1052094588 9:24369217-24369239 ATCACCAGACAGGAAACCCCTGG - Intergenic
1052311579 9:27074560-27074582 ATCACCAGACAGGGAACACCTGG - Intergenic
1052378162 9:27741388-27741410 GTCACCAGACAGGGAACCCCTGG - Intergenic
1052703053 9:31960623-31960645 GTCACAAGAAAGGGAACCCCTGG + Intergenic
1052767031 9:32651350-32651372 GTCACCAGACAGGGAACTCCTGG + Intergenic
1055208712 9:73763312-73763334 ATCATCAAACAGGGAGCCCCTGG + Intergenic
1055225051 9:73985230-73985252 GTCACCAGACTGGGAATCCCTGG + Intergenic
1056266026 9:84897472-84897494 AACACCACAGGGGGAACCCCTGG - Intronic
1056907428 9:90665777-90665799 ATCACCAGACAGGGAACTCCTGG + Intergenic
1056907512 9:90666216-90666238 ATCACCACACAGAGACCCCCTGG + Intergenic
1057180758 9:93028830-93028852 ATAATCAGACAGGGAAACCAAGG + Intronic
1057830884 9:98405850-98405872 ATCAACAGACGTGGAACCCATGG + Intronic
1061257993 9:129463923-129463945 TTCACCAGACAGGGAATCTGAGG - Intergenic
1061470645 9:130822562-130822584 ATCAAAAGACAGACAACCCCTGG - Intronic
1185890204 X:3815949-3815971 ATCACCTGCCCGGGGACCCCCGG - Intergenic
1186154942 X:6715767-6715789 ATCTCTATCCAGGGAACCCCAGG - Intergenic
1191155274 X:57266670-57266692 ATCACTAGACAGGGAATCCCTGG + Intergenic
1191743676 X:64463538-64463560 ATAACCAGAAAAAGAACCCCTGG - Intergenic
1191936920 X:66436728-66436750 ATGGCCAGACACAGAACCCCAGG + Intergenic
1192254301 X:69442855-69442877 ATCACCAGACAGGGAACCCCTGG - Intergenic
1192891941 X:75399452-75399474 ATCACCAGACAGGGAACCCCTGG + Intronic
1192926444 X:75759481-75759503 ATCACCAGACAAGGAACCCCTGG + Intergenic
1193005986 X:76618446-76618468 ATCACAAGAGAGGGAAACCCTGG + Intergenic
1193061681 X:77214258-77214280 ATCACCAGACAGGGAAACCCTGG - Intergenic
1193299090 X:79867826-79867848 ATCACTAGGCAGAGAACCCTTGG + Intergenic
1193482707 X:82046877-82046899 GTCACCAGACAGGGAACTTCTGG + Intergenic
1193497880 X:82236788-82236810 ATAATCAGACAGGGAACCCCTGG - Intergenic
1193714885 X:84926683-84926705 CACATCAGACAGGGAACCCTTGG - Intergenic
1193739631 X:85202723-85202745 ATCACCAGAAAGGGAATGCCTGG - Intergenic
1193789101 X:85797141-85797163 GTCACCAGATAGAGAACCCCTGG - Intergenic
1193858967 X:86640419-86640441 ATAACCAGACAGTAAACCCCTGG + Intronic
1194213087 X:91092689-91092711 ATCACCAGACACGGAACCCTTGG - Intergenic
1194247954 X:91538177-91538199 ACTGCCACACAGGGAACCCCTGG + Intergenic
1194593939 X:95835546-95835568 GTCACTAGACAGAGAACCCCTGG - Intergenic
1194781432 X:98029172-98029194 GTCACCAGACAAGAAACCCCAGG - Intergenic
1194838884 X:98714759-98714781 GTTACCAGGCAGAGAACCCCTGG - Intergenic
1194854655 X:98914634-98914656 ATCACCAGACAGTAAACCCTTGG - Intergenic
1194917553 X:99723571-99723593 ATCACCAGGCAGAAAACCCCTGG + Intergenic
1195074657 X:101314959-101314981 ATGGCAAAACAGGGAACCCCAGG + Intergenic
1195346314 X:103953987-103954009 GTCACCACACAGGAAACCCCTGG + Intronic
1195361141 X:104084858-104084880 GTCACCAGACAGGGAACCCCTGG - Intergenic
1196152615 X:112391986-112392008 ATCACCAGACAGGGAACTCCTGG - Intergenic
1197012656 X:121585902-121585924 ATCTGCAGATATGGAACCCCTGG - Intergenic
1197076925 X:122364044-122364066 ATCACCAGACAGGGAATCCCTGG - Intergenic
1197788435 X:130224287-130224309 CTCACCAGACACTGAACCACTGG + Intronic
1199306980 X:146278892-146278914 GTCACCTGACAGAGAAGCCCTGG - Intergenic
1199514821 X:148664342-148664364 ATGACATGACAGGGAACCACAGG - Intronic
1200566970 Y:4779706-4779728 ACTGCCACACAGGGAACCCCTGG + Intergenic
1201973491 Y:19820265-19820287 ATTATCAGACAGAGAATCCCTGG + Intergenic