ID: 1192254306

View in Genome Browser
Species Human (GRCh38)
Location X:69442868-69442890
Sequence GTCTGGTGATGAGCTCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192254299_1192254306 -3 Left 1192254299 X:69442848-69442870 CCACAAGCCAGGGGTTCCCTGTC No data
Right 1192254306 X:69442868-69442890 GTCTGGTGATGAGCTCTGAGGGG No data
1192254301_1192254306 -10 Left 1192254301 X:69442855-69442877 CCAGGGGTTCCCTGTCTGGTGAT 0: 11
1: 34
2: 35
3: 51
4: 189
Right 1192254306 X:69442868-69442890 GTCTGGTGATGAGCTCTGAGGGG No data
1192254293_1192254306 23 Left 1192254293 X:69442822-69442844 CCCAAGATGGAGGGTTTCTGCTG No data
Right 1192254306 X:69442868-69442890 GTCTGGTGATGAGCTCTGAGGGG No data
1192254294_1192254306 22 Left 1192254294 X:69442823-69442845 CCAAGATGGAGGGTTTCTGCTGT No data
Right 1192254306 X:69442868-69442890 GTCTGGTGATGAGCTCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192254306 Original CRISPR GTCTGGTGATGAGCTCTGAG GGG Intergenic
No off target data available for this crispr