ID: 1192260519

View in Genome Browser
Species Human (GRCh38)
Location X:69503895-69503917
Sequence GTCCTCGGGCAGGACGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192260510_1192260519 0 Left 1192260510 X:69503872-69503894 CCTTCAGCACCAAGGGCCGCCTT No data
Right 1192260519 X:69503895-69503917 GTCCTCGGGCAGGACGGTGAGGG No data
1192260512_1192260519 -9 Left 1192260512 X:69503881-69503903 CCAAGGGCCGCCTTGTCCTCGGG No data
Right 1192260519 X:69503895-69503917 GTCCTCGGGCAGGACGGTGAGGG No data
1192260507_1192260519 25 Left 1192260507 X:69503847-69503869 CCTCAGCAGCTAAGCTGGGAGCT No data
Right 1192260519 X:69503895-69503917 GTCCTCGGGCAGGACGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192260519 Original CRISPR GTCCTCGGGCAGGACGGTGA GGG Intergenic
No off target data available for this crispr