ID: 1192264934

View in Genome Browser
Species Human (GRCh38)
Location X:69531512-69531534
Sequence ACAGGCCCTGCTGGCACTAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 164}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192264934_1192264940 8 Left 1192264934 X:69531512-69531534 CCTTTAGTGCCAGCAGGGCCTGT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1192264940 X:69531543-69531565 ATGTGATGCTAGTGAGTGAATGG 0: 1
1: 0
2: 0
3: 12
4: 157
1192264934_1192264945 17 Left 1192264934 X:69531512-69531534 CCTTTAGTGCCAGCAGGGCCTGT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1192264945 X:69531552-69531574 TAGTGAGTGAATGGGAGGGCGGG 0: 1
1: 0
2: 0
3: 44
4: 391
1192264934_1192264942 12 Left 1192264934 X:69531512-69531534 CCTTTAGTGCCAGCAGGGCCTGT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1192264942 X:69531547-69531569 GATGCTAGTGAGTGAATGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 184
1192264934_1192264941 9 Left 1192264934 X:69531512-69531534 CCTTTAGTGCCAGCAGGGCCTGT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1192264941 X:69531544-69531566 TGTGATGCTAGTGAGTGAATGGG 0: 1
1: 0
2: 0
3: 12
4: 118
1192264934_1192264944 16 Left 1192264934 X:69531512-69531534 CCTTTAGTGCCAGCAGGGCCTGT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1192264944 X:69531551-69531573 CTAGTGAGTGAATGGGAGGGCGG 0: 1
1: 0
2: 3
3: 36
4: 372
1192264934_1192264946 22 Left 1192264934 X:69531512-69531534 CCTTTAGTGCCAGCAGGGCCTGT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1192264946 X:69531557-69531579 AGTGAATGGGAGGGCGGGCCTGG 0: 1
1: 0
2: 1
3: 28
4: 319
1192264934_1192264943 13 Left 1192264934 X:69531512-69531534 CCTTTAGTGCCAGCAGGGCCTGT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1192264943 X:69531548-69531570 ATGCTAGTGAGTGAATGGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192264934 Original CRISPR ACAGGCCCTGCTGGCACTAA AGG (reversed) Exonic