ID: 1192264934

View in Genome Browser
Species Human (GRCh38)
Location X:69531512-69531534
Sequence ACAGGCCCTGCTGGCACTAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 164}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192264934_1192264943 13 Left 1192264934 X:69531512-69531534 CCTTTAGTGCCAGCAGGGCCTGT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1192264943 X:69531548-69531570 ATGCTAGTGAGTGAATGGGAGGG 0: 1
1: 0
2: 1
3: 15
4: 207
1192264934_1192264946 22 Left 1192264934 X:69531512-69531534 CCTTTAGTGCCAGCAGGGCCTGT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1192264946 X:69531557-69531579 AGTGAATGGGAGGGCGGGCCTGG 0: 1
1: 0
2: 1
3: 28
4: 319
1192264934_1192264941 9 Left 1192264934 X:69531512-69531534 CCTTTAGTGCCAGCAGGGCCTGT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1192264941 X:69531544-69531566 TGTGATGCTAGTGAGTGAATGGG 0: 1
1: 0
2: 0
3: 12
4: 118
1192264934_1192264944 16 Left 1192264934 X:69531512-69531534 CCTTTAGTGCCAGCAGGGCCTGT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1192264944 X:69531551-69531573 CTAGTGAGTGAATGGGAGGGCGG 0: 1
1: 0
2: 3
3: 36
4: 372
1192264934_1192264940 8 Left 1192264934 X:69531512-69531534 CCTTTAGTGCCAGCAGGGCCTGT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1192264940 X:69531543-69531565 ATGTGATGCTAGTGAGTGAATGG 0: 1
1: 0
2: 0
3: 12
4: 157
1192264934_1192264942 12 Left 1192264934 X:69531512-69531534 CCTTTAGTGCCAGCAGGGCCTGT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1192264942 X:69531547-69531569 GATGCTAGTGAGTGAATGGGAGG 0: 1
1: 0
2: 2
3: 8
4: 184
1192264934_1192264945 17 Left 1192264934 X:69531512-69531534 CCTTTAGTGCCAGCAGGGCCTGT 0: 1
1: 0
2: 1
3: 9
4: 164
Right 1192264945 X:69531552-69531574 TAGTGAGTGAATGGGAGGGCGGG 0: 1
1: 0
2: 0
3: 44
4: 391

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192264934 Original CRISPR ACAGGCCCTGCTGGCACTAA AGG (reversed) Exonic
900392256 1:2438796-2438818 AGAGGCCCTTCTGGCACACAGGG - Intronic
900653831 1:3745217-3745239 AGTGGCCCTGCTGGCAGGAACGG - Intergenic
900792638 1:4690244-4690266 ACAGGCCCTGGTGACAGTGAAGG - Intronic
904458625 1:30662364-30662386 ACAGGCCCAGCAGGAACTGAAGG + Intergenic
906587702 1:46994362-46994384 ACAGGCACTGCCAGCACTAAGGG - Intergenic
910825468 1:91403169-91403191 AAAGTCCCTGCTTGCTCTAAAGG - Intronic
916727224 1:167533891-167533913 GCTGGCCCTGCTGGAACTGAGGG - Intronic
918959509 1:191255352-191255374 ACAAGCCCAGATGGCAATAATGG - Intergenic
919086690 1:192929024-192929046 GCAGGCCCTGCCTACACTAAGGG - Intergenic
920061012 1:203227037-203227059 ACAGACCCTGCTGGGGCAAAGGG - Intronic
920369679 1:205470384-205470406 ACACACCTTGCTGGCACAAATGG - Intergenic
924447194 1:244144297-244144319 AAGGGTCTTGCTGGCACTAAAGG - Intergenic
924724590 1:246657429-246657451 GCAGGCCCTGCTGAAACAAAAGG + Intronic
1067441098 10:46309598-46309620 TGAGGCCCTGCTGGCCCAAATGG + Intronic
1067577743 10:47418861-47418883 TGAGGCCCTGCTGGCCCAAATGG + Intergenic
1068408561 10:56625416-56625438 ACAGGCCCTGCAAGCTCTCAGGG - Intergenic
1069709898 10:70481506-70481528 AGAGCACCTGCTGGCACTTAAGG - Intronic
1069722851 10:70560690-70560712 AGAGCCCCTGCTGGCACTGCTGG + Intronic
1071337508 10:84612784-84612806 ACAGCCCCTGCTGACACGAGGGG + Intergenic
1071518334 10:86313831-86313853 ACAGGCCCAGCTGTCCCTCAGGG - Intronic
1071570431 10:86693664-86693686 AGATGCCCTGCAGGCACTGAAGG - Intronic
1073459924 10:103660556-103660578 GCAGGCCCTGCTGTCACCATGGG - Intronic
1075075936 10:119350136-119350158 ACAGGCCCATCTGGCAGTCATGG - Intronic
1075947954 10:126454315-126454337 ACAGGCCCTGAAGGCAGTAGGGG - Intronic
1077411108 11:2404330-2404352 AAAGCCCCTGCTGGCACCAGTGG - Intergenic
1078085746 11:8232180-8232202 ACAGGCCCTGCCGGGACTGCAGG - Intronic
1079069285 11:17329048-17329070 ACATACCCTGCTGGCCCAAAAGG - Intronic
1084557140 11:69881942-69881964 ATGGGCCCGGCTGGCACTGACGG - Intergenic
1085200820 11:74700920-74700942 CCAGGCCCAGCTGGGACTGATGG + Intronic
1089534141 11:119150180-119150202 AGGGGCCCTGCTGGCGCAAAAGG + Exonic
1091140357 11:133229115-133229137 ACAGGCCCAGCTGGCTCTCCGGG - Intronic
1091634178 12:2184990-2185012 ACAGGCCCTACTGGCAGCCATGG + Intronic
1098051892 12:66462936-66462958 TCAGACCCGGCTGGCCCTAAAGG - Exonic
1104771798 12:131368557-131368579 ACAGGCCATGCTGTCACTCCAGG - Intergenic
1107991621 13:45823737-45823759 ACAGTGCCTGCTGGCCCTGAAGG - Intronic
1108268827 13:48738694-48738716 ACAGGCCCCGATGGCACCAGTGG + Intergenic
1112085233 13:96024444-96024466 AGAAGACCTGGTGGCACTAACGG + Intronic
1113421360 13:110173953-110173975 ACAGGCCCAGCTGGCCAGAAAGG - Exonic
1117109430 14:52434757-52434779 GCAGGCCCTGCTAGCACAGAAGG + Intronic
1123042332 14:105495528-105495550 ACAGGTCCAGCTGGCACCAGGGG - Intronic
1128026887 15:64445525-64445547 ACAGGCGCTACAGGCACTACAGG - Intronic
1128736884 15:70058517-70058539 ACAGGCCCAGCAGGCACAGAAGG + Intronic
1130047583 15:80457849-80457871 ACAGGAGCTGCTGGAACAAAAGG - Intronic
1130273055 15:82462391-82462413 GCAGCCCATGCTGGCACTGATGG + Intergenic
1130353468 15:83110342-83110364 ACAGGTCCTGCAGGGACTCAGGG - Intronic
1130465408 15:84189762-84189784 GCAGCCCATGCTGGCACTGATGG + Intergenic
1130487285 15:84405058-84405080 GCAGCCCATGCTGGCACTGATGG - Intergenic
1130498857 15:84483774-84483796 GCAGCCCATGCTGGCACTGATGG - Intergenic
1130587696 15:85194357-85194379 GCAGCCCATGCTGGCACTGATGG + Intergenic
1132286670 15:100668510-100668532 TCAGGCCCTGCTGGCTGTGATGG + Intergenic
1133994528 16:10738362-10738384 ACAGGCCCTTCTGCCAGGAAAGG - Intergenic
1135570472 16:23545369-23545391 TCAGGCCCTGGTGGGACTCATGG + Intronic
1138499148 16:57427998-57428020 ACAGGTCCTGCTGAAACTCAAGG + Intergenic
1139692805 16:68651793-68651815 TCAGGCCCTGCTGGAAGTCAGGG + Intronic
1140635536 16:76908619-76908641 ACAGGCCCTGCCTGCCCTCAAGG + Intergenic
1142894066 17:2963382-2963404 ACGGGCACTGCCGGGACTAACGG + Intronic
1143164326 17:4890293-4890315 ACAGGCCCTGCTGCTGGTAACGG + Intronic
1145979046 17:29000951-29000973 ACAAGCAGTGGTGGCACTAAGGG + Intronic
1147012724 17:37464507-37464529 GCAGGAACTGCTGGCAGTAATGG - Intronic
1148675302 17:49441474-49441496 ACAGTCCCTGCTTTCACTTAGGG - Intronic
1148795372 17:50194401-50194423 CCTGGCCCTGCTGGCCCCAAAGG - Exonic
1150246898 17:63682847-63682869 ACAGGTTCTACTTGCACTAAAGG + Intronic
1152030702 17:77841015-77841037 ACAGGTGCTGCTTGCACTGAAGG + Intergenic
1152263280 17:79278585-79278607 ACAGGCCCGGCCGGCACCACAGG - Intronic
1156502884 18:37570781-37570803 GCAGGCCCTGCTGGCCCTGTAGG + Intergenic
1160157874 18:76447266-76447288 AGCGGCCCTGCTGGCACGACGGG + Intronic
1161800905 19:6416349-6416371 CCAGGCCCTGCTGGCCCAATGGG - Exonic
1163155709 19:15438986-15439008 AGAGGCCCTGCAGGCAGTAGAGG - Intronic
1163714564 19:18866298-18866320 ACAGGCCAAGCTGGCCCTGAGGG - Intronic
1163812469 19:19442259-19442281 AGGGGCCCTGCTGGCACAGATGG + Intronic
1164840686 19:31390182-31390204 CCAGGCCCTGCTGGGCCTCAGGG - Intergenic
1166259053 19:41625394-41625416 CCAGGCCCTGCAGACACTGATGG - Intronic
926853021 2:17221810-17221832 ACTGGCTCTGCAGGGACTAAGGG - Intergenic
927926515 2:27017415-27017437 ACAGGCACTGCTGCCACTCATGG + Intronic
928290355 2:30031279-30031301 ACAGACCCTGATGGAAATAAGGG - Intergenic
929449142 2:42025145-42025167 AGAGGCCCTGCATGCACTCAAGG - Intergenic
932471387 2:71961818-71961840 ACAGGGCCTGCTGGTATTCAGGG - Intergenic
938310358 2:130285274-130285296 ACAGGCCCAGCTGGTGCTGATGG + Intergenic
938444576 2:131367095-131367117 ACAGGCCCAGCTGGTGCTGATGG - Intergenic
939624734 2:144462872-144462894 GCAGGCCCTGTTGGAACTAATGG - Intronic
941674428 2:168328692-168328714 GCAGGCACTGCTGGCATGAATGG + Intergenic
942642172 2:178072126-178072148 ACCGGCCCAGCTGGGACTCAAGG + Exonic
943263184 2:185692640-185692662 ACAGGCACTGCTCACACTCAAGG - Intergenic
945174064 2:207023779-207023801 ACAGGGCCTGCTGCCACTGCTGG + Intergenic
949069356 2:242014144-242014166 GCAGACACTGCAGGCACTAAAGG - Intergenic
1169208166 20:3751509-3751531 AGAGGCCCTGCTGGCACGGCCGG + Exonic
1169354704 20:4896966-4896988 ACAGGCCCTGCAGGCTCCAAGGG - Intronic
1170354329 20:15475684-15475706 ACAGCACATGCTGACACTAACGG - Intronic
1170625106 20:18024446-18024468 ACAGGGCCTGACGTCACTAACGG + Exonic
1174898193 20:54472698-54472720 CCAGGAGCTGCTGGCACAAATGG - Intergenic
1178215703 21:30595359-30595381 ACAGGCCTTGCTCACACTCAAGG + Intergenic
1178289880 21:31358107-31358129 ACAGGTCCTGCAGGAACTGAAGG - Intronic
1180201346 21:46226404-46226426 ACAGGCCCTGATGGGGCCAAGGG + Intronic
1180626695 22:17198686-17198708 GATGGCCCTGCTGGCACTTATGG - Intronic
1183603379 22:38853134-38853156 GCAGTCCCTGCTGGCACACACGG - Intergenic
1183791384 22:40073325-40073347 ACAGGACTTGCTGTCCCTAAAGG - Intronic
1184032350 22:41902544-41902566 ACAGGCTCTGCTGCCACTTCAGG + Intronic
1184282037 22:43442806-43442828 TCAGCCCCTCCTGGCACTTAGGG + Intronic
1184380829 22:44143936-44143958 ACAAGCCCTGTTGGCAGAAATGG - Intronic
1185227167 22:49659717-49659739 GCAGGCTCAGCTGGCGCTAAGGG + Intergenic
950549130 3:13655640-13655662 ACAGGCACTAATGGCACTAATGG - Intergenic
951540977 3:23781480-23781502 CCAGGTCCTGCTGGCAGCAAAGG - Intergenic
953342543 3:42147673-42147695 ACAGGACCTGCTCTCACTAAAGG + Intronic
953457542 3:43054889-43054911 ACAGGCACAGGTGGCACAAAGGG + Intronic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
954573702 3:51663052-51663074 ACGGGGCCTGCTGGCACCAGAGG - Exonic
955403935 3:58613536-58613558 AGAGGCCTTGCTGGCACTCAGGG - Intronic
956475798 3:69618953-69618975 ACAGGTCCTGCCCACACTAAGGG + Intergenic
959136220 3:102424913-102424935 ACAGGCCCTGCTGAAAATCATGG - Intronic
962030505 3:131595408-131595430 ACAGTCCCTGTTGTCACAAATGG - Intronic
963162799 3:142169116-142169138 ACAATCACTGCTGGCAATAAAGG - Intronic
963943864 3:151123709-151123731 ACAGGCACTCCTAACACTAAAGG - Intronic
964663885 3:159151289-159151311 ACAGGGCCGGCTGGCATTCAGGG - Intronic
965110726 3:164418174-164418196 ACAGGCCATTATGGCATTAAAGG + Intergenic
965620450 3:170637637-170637659 ACAGGCCCTGTTTGCAATTATGG + Intronic
968448025 4:662272-662294 GCAGGCCCTCCTGGTACCAAGGG + Intronic
969872285 4:10112081-10112103 ACAGGGACTACTGGCACTACTGG + Intronic
972892321 4:43574161-43574183 ACAGGCTCTGCTTGCACTCAAGG - Intergenic
977955181 4:103018588-103018610 ACTGGCCCAGGTGGCACTGAGGG - Intronic
979272238 4:118776345-118776367 ACAAGCCCTCCTGGCATTAGAGG - Intronic
982124923 4:152176146-152176168 CCAGGCCCTGCTGGTAGCAAAGG - Intergenic
985665851 5:1181216-1181238 GCCGCCCCTGCTGGCACTACGGG + Intergenic
992626165 5:78637604-78637626 ACAGGCCCTCCTGGCATGCACGG + Intronic
994056893 5:95427154-95427176 ACAGACCCTGCTGTCCCTGAGGG + Intronic
996584060 5:125064972-125064994 GCAGGGCCTGCAGGCACTGAAGG + Intergenic
996895379 5:128475034-128475056 AGTGACCCTGCTGGCACTGATGG + Intronic
998543511 5:143005689-143005711 ACAGGCAATGCTTGAACTAATGG + Intronic
1001334176 5:170783935-170783957 ACAAGCCCTGCTGGGACCGAGGG + Intronic
1003569675 6:7247655-7247677 AAAGGCCCTCCTGACCCTAATGG - Intronic
1005736112 6:28748095-28748117 ACAGTCCCATCTGGCACTGATGG - Intergenic
1006523569 6:34586290-34586312 ACAGGCACTGAGGGCACTCATGG - Intergenic
1006637935 6:35473907-35473929 ACAGGCCCAGCTGGCTCTGGGGG + Exonic
1010795328 6:80111388-80111410 ACTGGCCCTGCTCCCACCAAGGG - Intronic
1013572744 6:111446096-111446118 ACAGGCCCATCTGACAGTAAAGG - Intronic
1016425928 6:143935419-143935441 ACCCACCCTGCTGGCACCAATGG - Intronic
1017235132 6:152111064-152111086 ACAGGCCCTGCTGCTAGTGAGGG - Intronic
1018186933 6:161273720-161273742 AGAGGCTCTGCTGGTACAAAAGG - Intronic
1019039938 6:169095418-169095440 ACAGGCCTTGCCGTCACTGACGG + Intergenic
1019610921 7:1936233-1936255 GCAGGCCCTGCTGGCCCTCATGG + Intronic
1019782899 7:2954755-2954777 ACACGCCCTGCTGGCAGAACAGG + Intronic
1022517157 7:30983394-30983416 ACACTCACTGCTGACACTAATGG - Intronic
1024182763 7:46913406-46913428 ACAGGCCCAGTTGGCTTTAAGGG - Intergenic
1026689534 7:72540013-72540035 CCAGGCCCTGCTGTCACAGATGG - Intergenic
1026849367 7:73715519-73715541 ACAGACCCTGCTGGAACCACGGG + Intronic
1034192370 7:149222240-149222262 ACAGGCCCTCCTTGCACTCGTGG - Intronic
1035402289 7:158574794-158574816 ACAGGCCTTGCTGGCACACTGGG + Intronic
1035742838 8:1941865-1941887 ACAGGTGCTGCTGGCACAACAGG + Intronic
1037998815 8:23373193-23373215 TCAGGCCCTGCTGGGAGTAGAGG + Intronic
1042849363 8:73200953-73200975 TCAGCCCCTGCAGGCACTACAGG + Intergenic
1043337204 8:79191204-79191226 ACAGGAACTGCTGCCACTATTGG + Intergenic
1043982552 8:86658378-86658400 ACAGGCCCAGCTGACCCTCATGG - Intronic
1045771814 8:105750302-105750324 ACAAGCCCTGCTGCCTCCAAGGG + Intronic
1045921048 8:107529514-107529536 ACAGGCCCTCCTTCCATTAATGG + Intergenic
1049330787 8:142049375-142049397 ACAGGCCTGGCTCACACTAAAGG - Intergenic
1049368673 8:142253174-142253196 ACAGCCCAGGCTGGCACTACGGG + Intronic
1049386949 8:142347615-142347637 ACAGGCCCTGCTGTCACTCAAGG + Intronic
1049798288 8:144506337-144506359 ACAGGCCCTGCTGGACCTGGTGG + Exonic
1051223764 9:14877514-14877536 ACAGATTCTGCTGGCACTCAAGG - Intronic
1053396300 9:37777434-37777456 ACAGGCTCTGCTTGCTCTCAAGG - Intronic
1055822636 9:80285956-80285978 CCAGGCCCTGCTGGTAATAGGGG - Intergenic
1056755983 9:89382440-89382462 ACAGGCCCTGATGCCAATACAGG + Intronic
1057390474 9:94638568-94638590 ACAAGCCCTGCTGCTCCTAAAGG + Intronic
1057950726 9:99367295-99367317 AAAGGCCTTGTGGGCACTAAAGG - Intergenic
1059298526 9:113294461-113294483 ACAGGCCATGCTGGCTGTACCGG - Intergenic
1060650666 9:125323866-125323888 GCAGGACCTTCTGGCAGTAATGG + Exonic
1060882737 9:127129722-127129744 ATAGGCCCTGCAGGGAGTAAAGG + Intronic
1061175538 9:128994025-128994047 ATTGGACCTGCTGGCACAAAGGG + Intronic
1062715657 9:138008900-138008922 CCAGGCCCTGCTGGCATTTGGGG - Intronic
1192264934 X:69531512-69531534 ACAGGCCCTGCTGGCACTAAAGG - Exonic
1192308575 X:69989155-69989177 CCAGGCCCTGCTGGCATCAGGGG - Intronic
1194562276 X:95437151-95437173 ACAGGGCCAGCTGAGACTAAGGG - Intergenic
1198040461 X:132846549-132846571 GCAGGTCCTGCTGTCTCTAATGG - Intronic
1199725655 X:150577971-150577993 ACAGGTCCTGCTCACACTCAAGG - Intronic
1199894435 X:152117405-152117427 TCAAGCCCTGCTGGGAGTAAAGG - Intergenic
1200838083 Y:7752513-7752535 ACAGGCCCTGCCCCCACTCAAGG - Intergenic