ID: 1192266667

View in Genome Browser
Species Human (GRCh38)
Location X:69543443-69543465
Sequence TGGGTTGACTCCCAGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192266656_1192266667 29 Left 1192266656 X:69543391-69543413 CCTCAAGCCAGGGCCTGGGCCGG No data
Right 1192266667 X:69543443-69543465 TGGGTTGACTCCCAGAGGCTGGG No data
1192266660_1192266667 16 Left 1192266660 X:69543404-69543426 CCTGGGCCGGGAAAGCCAAAATT No data
Right 1192266667 X:69543443-69543465 TGGGTTGACTCCCAGAGGCTGGG No data
1192266661_1192266667 10 Left 1192266661 X:69543410-69543432 CCGGGAAAGCCAAAATTTACTTC No data
Right 1192266667 X:69543443-69543465 TGGGTTGACTCCCAGAGGCTGGG No data
1192266659_1192266667 22 Left 1192266659 X:69543398-69543420 CCAGGGCCTGGGCCGGGAAAGCC No data
Right 1192266667 X:69543443-69543465 TGGGTTGACTCCCAGAGGCTGGG No data
1192266655_1192266667 30 Left 1192266655 X:69543390-69543412 CCCTCAAGCCAGGGCCTGGGCCG No data
Right 1192266667 X:69543443-69543465 TGGGTTGACTCCCAGAGGCTGGG No data
1192266662_1192266667 1 Left 1192266662 X:69543419-69543441 CCAAAATTTACTTCTTGCTCAAC No data
Right 1192266667 X:69543443-69543465 TGGGTTGACTCCCAGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192266667 Original CRISPR TGGGTTGACTCCCAGAGGCT GGG Intergenic
No off target data available for this crispr