ID: 1192269002

View in Genome Browser
Species Human (GRCh38)
Location X:69561004-69561026
Sequence CATCACATGATGAAGTAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192268996_1192269002 2 Left 1192268996 X:69560979-69561001 CCCACAAAACTAGACACCAGTGG No data
Right 1192269002 X:69561004-69561026 CATCACATGATGAAGTAGAATGG No data
1192268998_1192269002 1 Left 1192268998 X:69560980-69561002 CCACAAAACTAGACACCAGTGGG No data
Right 1192269002 X:69561004-69561026 CATCACATGATGAAGTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192269002 Original CRISPR CATCACATGATGAAGTAGAA TGG Intergenic
No off target data available for this crispr