ID: 1192273067

View in Genome Browser
Species Human (GRCh38)
Location X:69601805-69601827
Sequence ACCTCGAATAACCAACATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192273064_1192273067 23 Left 1192273064 X:69601759-69601781 CCATTTTGTCACAATGAAATAGA No data
Right 1192273067 X:69601805-69601827 ACCTCGAATAACCAACATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192273067 Original CRISPR ACCTCGAATAACCAACATTA GGG Intergenic
No off target data available for this crispr