ID: 1192274748

View in Genome Browser
Species Human (GRCh38)
Location X:69616927-69616949
Sequence TCGCGCGCGCCCGCGGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 243}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192274744_1192274748 -4 Left 1192274744 X:69616908-69616930 CCCCTTGACTTGGAAAGTCTCGC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG 0: 1
1: 0
2: 4
3: 30
4: 243
1192274740_1192274748 12 Left 1192274740 X:69616892-69616914 CCAGACTCCCTGGGGACCCCTTG 0: 1
1: 0
2: 1
3: 27
4: 214
Right 1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG 0: 1
1: 0
2: 4
3: 30
4: 243
1192274742_1192274748 5 Left 1192274742 X:69616899-69616921 CCCTGGGGACCCCTTGACTTGGA 0: 1
1: 0
2: 2
3: 18
4: 165
Right 1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG 0: 1
1: 0
2: 4
3: 30
4: 243
1192274735_1192274748 22 Left 1192274735 X:69616882-69616904 CCCAGCTAATCCAGACTCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG 0: 1
1: 0
2: 4
3: 30
4: 243
1192274746_1192274748 -6 Left 1192274746 X:69616910-69616932 CCTTGACTTGGAAAGTCTCGCGC 0: 1
1: 0
2: 0
3: 0
4: 42
Right 1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG 0: 1
1: 0
2: 4
3: 30
4: 243
1192274737_1192274748 21 Left 1192274737 X:69616883-69616905 CCAGCTAATCCAGACTCCCTGGG 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG 0: 1
1: 0
2: 4
3: 30
4: 243
1192274743_1192274748 4 Left 1192274743 X:69616900-69616922 CCTGGGGACCCCTTGACTTGGAA 0: 1
1: 0
2: 3
3: 14
4: 149
Right 1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG 0: 1
1: 0
2: 4
3: 30
4: 243
1192274745_1192274748 -5 Left 1192274745 X:69616909-69616931 CCCTTGACTTGGAAAGTCTCGCG 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG 0: 1
1: 0
2: 4
3: 30
4: 243
1192274734_1192274748 27 Left 1192274734 X:69616877-69616899 CCTGGCCCAGCTAATCCAGACTC 0: 1
1: 0
2: 4
3: 25
4: 248
Right 1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG 0: 1
1: 0
2: 4
3: 30
4: 243
1192274733_1192274748 28 Left 1192274733 X:69616876-69616898 CCCTGGCCCAGCTAATCCAGACT 0: 1
1: 0
2: 3
3: 14
4: 149
Right 1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG 0: 1
1: 0
2: 4
3: 30
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192274748 Original CRISPR TCGCGCGCGCCCGCGGCCCC TGG Intronic
900349558 1:2228181-2228203 TCGCGCCCGCCGCCGGCCCCCGG - Intergenic
900414007 1:2526777-2526799 GCCCGCCCGCCCGCAGCCCCGGG - Intergenic
901086732 1:6615195-6615217 TCCCGCGCGCCCCCGGCCCGAGG + Intronic
901551344 1:9997798-9997820 GGGAGCGCGCCCGGGGCCCCGGG - Intronic
901556070 1:10032641-10032663 TGGCGCTGGCCCGCGGCCCGGGG - Intergenic
901641258 1:10694246-10694268 CCGCCCGAGACCGCGGCCCCCGG + Intronic
901641433 1:10694890-10694912 GCGAGCGCGCGCGCGGCCGCCGG - Intronic
902350028 1:15847647-15847669 GCGCGCGCGCCCGCGGCGAGGGG + Intergenic
903115582 1:21176451-21176473 TCCCGCCCCCCCGCTGCCCCCGG - Intronic
903349952 1:22711328-22711350 CCACGCGCGCTCGCCGCCCCCGG + Intronic
903652369 1:24929917-24929939 GCGCCCGCGCCGGCCGCCCCCGG - Intronic
905734565 1:40316649-40316671 ACCCGCGCGCCCGCAGCCCCCGG + Intronic
906357121 1:45115973-45115995 TGGCGCGCGCCCGCAATCCCAGG + Intronic
906637076 1:47416835-47416857 GCGCACGCGGCCGCGGCGCCAGG + Exonic
906719746 1:47996717-47996739 TCGCGCCCGCCCGCAGCCCCCGG - Exonic
913191747 1:116418759-116418781 GCGCGCCCGGCTGCGGCCCCAGG + Intergenic
913654088 1:120944883-120944905 ACGCGCGCGTCCGCTGGCCCAGG + Intergenic
918365650 1:183805130-183805152 TCGCGCGCACCGGCGGCGGCGGG + Intronic
922739419 1:228007004-228007026 ACCCGCGCACCCGCGGCCGCAGG + Intergenic
922925409 1:229343088-229343110 CCACGCGCGCTCCCGGCCCCCGG + Intronic
923055886 1:230425902-230425924 CCGCGCGCCCCCGCCGCCCTCGG + Intergenic
924560603 1:245154574-245154596 ACGCTCGCTCGCGCGGCCCCCGG + Intergenic
1062843805 10:689765-689787 TCGCGCGCCCCCGCGCCCCACGG + Intergenic
1062932671 10:1363272-1363294 TTGCGCTCGCCCGGGGCCGCGGG + Exonic
1065022324 10:21510380-21510402 TAGCCCGCGCCAGCAGCCCCCGG + Intergenic
1065099107 10:22316329-22316351 CCGCGCGCGCACGCGGCTCGGGG - Exonic
1065390076 10:25174574-25174596 TCCCGCGCCCCCGCCGCCCGCGG + Intergenic
1067686064 10:48466575-48466597 TGTTGCGCGCCCGCCGCCCCAGG - Intronic
1069651680 10:70053646-70053668 GCACGCCCGCCCGCGGCGCCCGG - Intronic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1072089639 10:92115043-92115065 TCCCCCGCGCCCGCGGCCGCCGG - Intronic
1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG + Exonic
1075040584 10:119104269-119104291 GCCCGGGCTCCCGCGGCCCCCGG + Intronic
1075501692 10:122980580-122980602 TCGCGCGCGCCCTCGCCCACCGG + Exonic
1076879070 10:133231126-133231148 GCGCGCCCGTCCGCGGCCCCGGG + Exonic
1076916329 10:133424516-133424538 TCCCGCTCGGCCGCGGCCTCAGG - Exonic
1076936436 10:133569311-133569333 TCCCGCTCGGCCGCGGCCTCAGG - Intronic
1077124323 11:925745-925767 GCGCGCGCGTCCGCGGCACGGGG - Intronic
1077360790 11:2139422-2139444 TCGCGCCAGCCCGCGGCCCAGGG + Intronic
1079361997 11:19777273-19777295 CCGCGCGCAGCAGCGGCCCCGGG + Intronic
1080283593 11:30585375-30585397 CGGCGCGCGCGGGCGGCCCCGGG + Intronic
1081804985 11:45885616-45885638 CCGCGCGCGCCCCCGGGACCCGG - Intergenic
1081831604 11:46120387-46120409 CCGCCCCCGCCCGCAGCCCCCGG + Intronic
1082243233 11:49892218-49892240 TCCCGGGAGCCCGCGGCCTCTGG + Intergenic
1083670942 11:64299674-64299696 CCGTGCGGCCCCGCGGCCCCGGG + Exonic
1083835144 11:65261831-65261853 ACGCGCGCACGCGCGGCCCAGGG - Exonic
1086697660 11:89864041-89864063 TCCCGGGAGCCCGCGGCCTCTGG + Intergenic
1086708499 11:89980447-89980469 TCCCGGGAGCCCGCGGCCTCTGG - Intergenic
1087782637 11:102317631-102317653 GCGCGCGCGCGCGCCTCCCCTGG + Intronic
1088223180 11:107591052-107591074 GCGCCCGCGCCCCCGGCTCCCGG + Intergenic
1091563261 12:1630163-1630185 TCTCGCGCGTCGGCGTCCCCAGG - Intronic
1096983627 12:55743152-55743174 GCCCGCGCGCCCGCCGCCCCCGG + Intergenic
1098161069 12:67648737-67648759 GGGCGCGCGCGCGCGGGCCCGGG + Exonic
1100260652 12:92929334-92929356 GCGGGCCCGCCCGCGGCCGCCGG + Intergenic
1100315473 12:93441485-93441507 TCCCGCGCGCCCGCGGCCTCCGG + Intronic
1100329514 12:93571006-93571028 TCGCGCGCACTCGCTGCTCCTGG + Intronic
1100539955 12:95548597-95548619 TTCCGCGCGCCCGCAGCCCCAGG + Intronic
1102025845 12:109714026-109714048 TCTCACGCGCCCATGGCCCCGGG - Intergenic
1103364006 12:120369315-120369337 CCGCGCTCGCCCGCGAGCCCGGG + Intergenic
1103509774 12:121466762-121466784 ACGCGCGTGCCGGCTGCCCCGGG - Intronic
1104049446 12:125186154-125186176 CCGCGAGCGCCCGCGACCCCCGG + Intergenic
1104568284 12:129903892-129903914 GCGCGCGCGCCCGAGCCCCGAGG - Intergenic
1104697284 12:130872532-130872554 TCGCGCGGCCCCGCAGCCCATGG - Intronic
1106340271 13:28820347-28820369 TAGCGAGCGCCGGCGGCTCCAGG + Exonic
1107604049 13:42040861-42040883 TCGCGCCAGCCCGCGCCCGCCGG - Intronic
1109062067 13:57632450-57632472 TCGCGCGCGCACGCTGCGCCAGG + Exonic
1111657918 13:91175408-91175430 TCGCTTGGGCCCGCGGCTCCCGG - Intergenic
1113541932 13:111115706-111115728 GCGCCCCCGCCCGCGCCCCCCGG + Intronic
1114422796 14:22598534-22598556 ACGCGCTCGCCCGCAGCCCGGGG + Intronic
1117092847 14:52267925-52267947 CCGAGCGCGCCAGCAGCCCCAGG - Exonic
1117841947 14:59869933-59869955 GCGGGCAGGCCCGCGGCCCCTGG - Intronic
1118404807 14:65412732-65412754 TCGCGCGCGCACGCCGGCGCTGG + Intronic
1122145124 14:99684311-99684333 CCGCGCGCCGCCTCGGCCCCAGG - Exonic
1122418058 14:101559855-101559877 TCCCGTGCGCCTGCCGCCCCGGG - Intergenic
1122688986 14:103522733-103522755 GCGCGGACGCCCCCGGCCCCCGG + Intronic
1123024986 14:105420167-105420189 CCGCCCGCCCTCGCGGCCCCCGG + Intronic
1123034594 14:105466749-105466771 CAGCGCCCGCCCGCGGCTCCAGG - Intronic
1124129392 15:26971211-26971233 CCGCGCCCGCTCGCGGCTCCAGG + Intergenic
1129644849 15:77420265-77420287 ACGCGCGCGCTCACGGGCCCCGG + Intergenic
1129933692 15:79432180-79432202 GCCCGCGCTCCAGCGGCCCCGGG - Intergenic
1130002613 15:80060055-80060077 GCGCGGGCGCCCGCGGCCGGGGG + Intronic
1131517612 15:93089322-93089344 CCGCGCGCGCCCCCCGCCCGCGG - Intergenic
1131969270 15:97875750-97875772 CCGCGCGCAGCCGCGGCTCCCGG - Intergenic
1132055548 15:98648510-98648532 TCGCGCGCGCGCGCGCGCCCTGG - Intergenic
1132398160 15:101489316-101489338 TCGCGCGCGCCGGAGGCCGCCGG + Intronic
1132594296 16:741182-741204 TCCCGCGCGCCCCAGGCCCCGGG + Intronic
1132724945 16:1334415-1334437 CTGCGGGCGCCCGGGGCCCCGGG + Intronic
1132778868 16:1612314-1612336 CCCCGCGCGCCCGCGCACCCCGG + Exonic
1133029733 16:3004659-3004681 ACGAGCGCGCCCACGGGCCCAGG - Intergenic
1133212963 16:4273216-4273238 GCAAGCCCGCCCGCGGCCCCCGG - Intergenic
1133259424 16:4538559-4538581 CCGCCCCCGCCCGCGGCGCCTGG - Intronic
1133286594 16:4693630-4693652 CCGCGGGCGGCCGCGCCCCCGGG - Intergenic
1133340664 16:5033668-5033690 GCGCGCGCGCGCGCCTCCCCCGG - Exonic
1134419403 16:14071589-14071611 TCGCGCCCGGGCGCGACCCCGGG + Intronic
1134529890 16:14975087-14975109 TCCCCCGCGCCCGCGGCCGGCGG - Exonic
1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG + Exonic
1136220409 16:28824117-28824139 GCGCGCGCGCCAGAGGCTCCCGG - Intronic
1136428369 16:30183797-30183819 CCGCGCGCCCCCGCAGCCCGCGG - Intronic
1137261154 16:46831054-46831076 CCGCCCGCGCGCCCGGCCCCCGG + Intronic
1139496930 16:67326761-67326783 GCGCGCGCCGCCGCGACCCCGGG - Exonic
1139866454 16:70065867-70065889 TCCCCCGCGCCCGCGGCCAGCGG + Intergenic
1140078599 16:71723830-71723852 TCCAGCGGGCCCGCGGGCCCCGG + Intronic
1140462248 16:75148961-75148983 TCCCGCGCGCGCGCGCCCGCCGG - Intronic
1141989770 16:87603059-87603081 TCGCGGCCGCCGGCGGCCCTGGG - Exonic
1142209886 16:88803982-88804004 GCCCGCCCGCCCGCCGCCCCCGG + Exonic
1142623586 17:1179521-1179543 TCGCCCCCGCCCGCGCTCCCCGG + Intronic
1142664733 17:1456155-1456177 GCGCGCGCCCCTCCGGCCCCCGG + Exonic
1144756026 17:17681329-17681351 CTGCGCTCGCTCGCGGCCCCGGG - Intergenic
1145969664 17:28949697-28949719 GCCCGCGCGCCCGCTGCCCTCGG - Intronic
1146058597 17:29593212-29593234 GGACGCGCGCCCGCAGCCCCCGG - Intronic
1146271483 17:31488328-31488350 TCGGCCCGGCCCGCGGCCCCGGG + Intronic
1146283416 17:31559417-31559439 TCGAGCGAGGCCACGGCCCCCGG + Intergenic
1147168700 17:38606044-38606066 TCCCCCGCCCCCGCCGCCCCGGG - Intergenic
1147684052 17:42276405-42276427 GCGCGCGCCCCCGCGGGCCCCGG - Exonic
1147992870 17:44345660-44345682 TCGCGCGCCCCTCCGGCTCCAGG - Intronic
1148206841 17:45784604-45784626 GCGCTGGCGCCCCCGGCCCCTGG + Intronic
1148406792 17:47423425-47423447 TCGGCTGCGCCCGCGGCCCGGGG + Intronic
1149858082 17:60102668-60102690 TCCGCCGCGCCCGCGGCCCGCGG - Intergenic
1149865785 17:60150227-60150249 TCCCGCACCCTCGCGGCCCCCGG - Intronic
1151296858 17:73192576-73192598 TCGGGCGCGCTCGCCGCCGCTGG - Intergenic
1152628500 17:81399324-81399346 GCGTGCGCGCGCGGGGCCCCGGG + Intronic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1153457324 18:5295578-5295600 TCGCCGGCCCGCGCGGCCCCCGG + Intronic
1156488920 18:37485211-37485233 TCGATCGCGCACGCGGCCCGCGG + Intronic
1157338169 18:46756517-46756539 TACCCCGCGCCCGCGGCGCCCGG - Exonic
1158579731 18:58671292-58671314 TCGCCCTCCCCCGCGGTCCCGGG - Intergenic
1160163400 18:76491733-76491755 GCGCTCTCGCCCCCGGCCCCTGG + Intronic
1160592140 18:79951001-79951023 CCGCGCGCTCCTGCGGCCTCGGG + Exonic
1160914766 19:1491220-1491242 TCGAGCTCGCCCGCGGACCAGGG - Exonic
1160968604 19:1757571-1757593 CCGCGCGGCCCCGCGGCCGCGGG + Intronic
1162727055 19:12696126-12696148 GGGCGGGCGCCCCCGGCCCCCGG + Intronic
1163708632 19:18832393-18832415 GCGCCCGCGCCCGCGCCGCCCGG - Exonic
1163715183 19:18869127-18869149 CCGCGCGCACTGGCGGCCCCAGG + Exonic
1164834757 19:31349901-31349923 GCGCCCCCGCCCCCGGCCCCAGG + Intergenic
1165080106 19:33302068-33302090 CCGGGCGCGCCCGCGGGCCCCGG - Exonic
1166706105 19:44908881-44908903 CCGCGAGCGCCTGGGGCCCCTGG + Exonic
1166840222 19:45692711-45692733 GCGGGGTCGCCCGCGGCCCCCGG - Exonic
1167643782 19:50695248-50695270 CCCCGCGCCCCCGCGCCCCCCGG - Intronic
1168297302 19:55383736-55383758 CTGCCCGCGCCCGCCGCCCCGGG + Exonic
1168307219 19:55442324-55442346 GCCCTCGCCCCCGCGGCCCCCGG + Exonic
926914337 2:17878497-17878519 CCGCCCGCGCCCTCGGCCCGGGG + Intronic
927713654 2:25340433-25340455 TCGCTGGGGCCCGCGGCCCTGGG - Intronic
927851595 2:26503330-26503352 CCGCGCCCTCCAGCGGCCCCAGG + Intronic
929033705 2:37671800-37671822 CCGCGCGCGCGCCCGGCCACCGG - Exonic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
931052304 2:58428486-58428508 GCGCGCGCGGCGGCCGCCCCGGG - Intergenic
931711000 2:64989165-64989187 GCCCGCGCCCCCGCGGCCTCGGG + Intronic
933858579 2:86441903-86441925 CCGCGCGAGGACGCGGCCCCGGG - Intronic
934763811 2:96869630-96869652 TGGCGCGCCCCTCCGGCCCCGGG + Intronic
936713612 2:115161428-115161450 ACCCGCGCGCCCACGGCCGCCGG - Intronic
937134926 2:119544403-119544425 TCGCGCCCGGCCGCCGGCCCTGG + Intergenic
937379970 2:121367684-121367706 AGTCTCGCGCCCGCGGCCCCGGG + Exonic
937950910 2:127387575-127387597 TCGCGCGCCCCTCCGGTCCCCGG - Intronic
938073925 2:128322224-128322246 TCGCGCGGACCCGCGGGGCCCGG + Intergenic
946227027 2:218269658-218269680 CCGCGCGCCCCCGCGGACCCCGG - Intronic
946966425 2:225042203-225042225 TCCCGCGCGCCCCAGGCGCCCGG - Intronic
948945699 2:241217976-241217998 CTGCGCGCCCCCGCTGCCCCCGG - Intronic
1168753059 20:297512-297534 TCGCGCGCGCCCGCCCGCCGGGG - Exonic
1168765760 20:380972-380994 TCTCGTGCGCGCCCGGCCCCCGG - Exonic
1169278434 20:4248722-4248744 CCGCCCGCGCCCGCGCTCCCCGG + Exonic
1170999273 20:21396833-21396855 CCGCGCGCCCGCTCGGCCCCAGG + Intronic
1170999285 20:21396880-21396902 TCCCGCGCCCCCGCGCCCCTCGG + Intronic
1174204477 20:48828486-48828508 ACGCGCGCCTCCGCGGCCCCGGG + Intergenic
1175859621 20:62143363-62143385 CCGCGCGCACCCGCGACTCCCGG + Exonic
1176221029 20:63969524-63969546 CCGCGCCCGCTCCCGGCCCCAGG - Intronic
1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG + Intergenic
1176550192 21:8217423-8217445 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1176551677 21:8225580-8225602 TGGCGCGTGCCCGCGGTCCCAGG - Intergenic
1176555787 21:8253491-8253513 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176569120 21:8400461-8400483 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1176570586 21:8408579-8408601 TGGCGCGTGCCCGCGGTCCCAGG - Intergenic
1176574724 21:8436525-8436547 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1176577034 21:8444693-8444715 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1176578495 21:8452746-8452768 TGGCGCGTGCCCGCGGTCCCAGG - Intergenic
1176611338 21:8987818-8987840 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1179968046 21:44818153-44818175 CTGCGCGCGCCCGACGCCCCGGG - Intronic
1180005615 21:45019144-45019166 TGCCCCGCGCCCGCCGCCCCCGG + Intergenic
1180064234 21:45404916-45404938 TCGCCCGTCCCCGCCGCCCCCGG + Intergenic
1181007527 22:20021088-20021110 TGGCGCGCGGGCGCGGCACCCGG + Exonic
1181610871 22:24011169-24011191 ACGCGCGCGCGCGCCGCCCAAGG + Intergenic
1181645786 22:24231325-24231347 TCCCCCGCACCCCCGGCCCCCGG - Intronic
1182296497 22:29313551-29313573 TCGGGCGCGCCCGCCGGCCTGGG + Exonic
1182804349 22:33058003-33058025 TCTTGCGCGCCCCCGGCTCCCGG + Intronic
1183601649 22:38843698-38843720 TCGGGCGCCGCCGCGTCCCCGGG - Exonic
1183601692 22:38843872-38843894 GCGGGGGCGCCCGAGGCCCCCGG + Exonic
1183788448 22:40045344-40045366 GCGGGCGCGCGCGCGGCTCCGGG + Intronic
1185255202 22:49827757-49827779 GCGCCCGCGCCCGCGCCCGCCGG - Intergenic
1203252772 22_KI270733v1_random:125576-125598 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203255087 22_KI270733v1_random:133761-133783 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1203256696 22_KI270733v1_random:142500-142522 TGGCGCGTGCCCGCGGTCCCAGG - Intergenic
1203260828 22_KI270733v1_random:170662-170684 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203263143 22_KI270733v1_random:178840-178862 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
949559480 3:5188332-5188354 GCGCGTGGGCGCGCGGCCCCGGG - Intronic
950021710 3:9792415-9792437 CCGCCCCCTCCCGCGGCCCCTGG - Exonic
950729827 3:14947765-14947787 CCCCGCGAGCCCGCGGCCCCCGG + Intronic
953326104 3:42013709-42013731 GCGCCCCCGCCCGCCGCCCCGGG + Intergenic
956179087 3:66500933-66500955 GCGCGCGCGCGCGCAGCCTCGGG + Intronic
963253210 3:143120520-143120542 CCGGGCGCGCCCTCGGCTCCAGG + Exonic
966378835 3:179323335-179323357 GCCCGCACGCCCGCGTCCCCTGG - Intronic
967054963 3:185823795-185823817 CCGCGCGGGCCCCCGGGCCCCGG - Intronic
967858543 3:194135208-194135230 CCGCGGGCGGCCTCGGCCCCCGG - Intergenic
968514951 4:1011966-1011988 GCGCGCGCGGCCGCGACCCCAGG + Intronic
969647491 4:8440980-8441002 GCGCGGAGGCCCGCGGCCCCGGG + Exonic
969720873 4:8892587-8892609 TCGGAGGCGCCCGGGGCCCCGGG + Intergenic
973246744 4:48017377-48017399 ACGCCCACCCCCGCGGCCCCGGG - Intronic
975710698 4:77157654-77157676 TCGCGGGCGCCAGCTCCCCCCGG - Intronic
975778724 4:77818755-77818777 TCGCGCGGGCTCGCCGTCCCGGG + Intronic
975778926 4:77819520-77819542 GCGCGCCCGCCCGCGAGCCCCGG - Intronic
978646992 4:110945838-110945860 TGGCGCCCGGCCGCGGCCCAAGG + Intergenic
981782880 4:148445562-148445584 CCGCGCGCCCCCGCGTCTCCTGG + Intergenic
985068446 4:186144978-186145000 TCACGCGCCCCCGCGGCCCCGGG - Exonic
986184508 5:5423011-5423033 CCCCCCGCGCCCGGGGCCCCGGG - Intronic
992487591 5:77210878-77210900 CCGCCCGCGCCCGCGGCCGCCGG - Exonic
997326505 5:133026348-133026370 TCGCCCGGGCCCGAGCCCCCCGG + Intronic
998193105 5:140043330-140043352 TCTCGCGCCCCCTCTGCCCCCGG + Intergenic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1002692433 5:181059580-181059602 GCGCGTGCCCCCGCGGCGCCTGG + Exonic
1005685728 6:28251775-28251797 TCGCGGGGGCCCGCAGCCTCCGG + Exonic
1007673408 6:43575653-43575675 TCTCCCGCCCACGCGGCCCCTGG - Intronic
1010032869 6:71288735-71288757 GCGCGCGCGGCGGCGGTCCCGGG + Intergenic
1010703454 6:79078339-79078361 TGGCCCGCGCCCCCGCCCCCCGG + Intergenic
1010926726 6:81753333-81753355 CCGCGCACGCCCGAGGCCCGTGG - Intergenic
1013048896 6:106512697-106512719 CCCCGCCCGCCAGCGGCCCCCGG + Exonic
1013272873 6:108559641-108559663 TCGCGCGCGCCTGCGCGGCCCGG - Intergenic
1014632489 6:123803736-123803758 TCGCGCGCTTCTGCCGCCCCCGG + Intergenic
1015654158 6:135497907-135497929 TCGCGCCCGCCTGCGGCCTGAGG - Intergenic
1016863962 6:148747769-148747791 CCGCGCGCCGCCGCCGCCCCGGG + Intronic
1020125230 7:5529743-5529765 GGGCGCGCGCCGGCGCCCCCTGG - Intronic
1020125536 7:5530844-5530866 CGGCGCGCGCCCCCAGCCCCCGG - Intronic
1021106787 7:16646528-16646550 GCCCGCCCGCCCGCGGTCCCAGG - Intronic
1022018501 7:26376430-26376452 CCGCGCGGGCCTGCGGCTCCCGG + Intergenic
1023881813 7:44325180-44325202 ACCCGCGAGCCCCCGGCCCCGGG - Intronic
1025796165 7:64739431-64739453 TGGCGCGCGCCCGCAACCGCAGG + Intergenic
1026471159 7:70694761-70694783 TCCAGCGCGGCCGAGGCCCCGGG - Intronic
1029537334 7:101164165-101164187 GCGCGCGCCCCTGCCGCCCCCGG - Exonic
1029701420 7:102248911-102248933 TCCCGGGCGCCCGCGGCCTCGGG - Exonic
1032074566 7:128830335-128830357 CCCGCCGCGCCCGCGGCCCCCGG - Intergenic
1034147048 7:148883546-148883568 TCGCGCACGCCCCCGGTCCCGGG - Intronic
1034147077 7:148883625-148883647 TCCCGCCCGCCGGCGGGCCCGGG + Intronic
1034962659 7:155372435-155372457 TCACCCCCGCCCGCCGCCCCAGG + Intergenic
1036910381 8:12754072-12754094 CCGCGCGGGCGCCCGGCCCCGGG - Intronic
1037819912 8:22130584-22130606 TAGAGCGCCCCCGCCGCCCCGGG - Exonic
1037901081 8:22690162-22690184 TGGCGCGGCCCGGCGGCCCCTGG + Exonic
1038017710 8:23529276-23529298 TCCCGCGCGCCGGCAGCCTCGGG + Intronic
1040582573 8:48709198-48709220 CCGCCAGTGCCCGCGGCCCCAGG - Intergenic
1041068172 8:54101966-54101988 CCGCGCGCGCCCGCGCGTCCAGG + Exonic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1042591775 8:70403662-70403684 CCGCCCGCCCTCGCGGCCCCGGG + Intronic
1047393725 8:124475033-124475055 CCGCCCCCGGCCGCGGCCCCGGG + Exonic
1049719265 8:144108128-144108150 CCCCGCGCGCCCGCGCCCGCCGG + Exonic
1052494719 9:29212448-29212470 TCGCGCGCCCCCGAGTCCGCAGG + Intergenic
1052982322 9:34458319-34458341 CCGCGCGGGGCGGCGGCCCCAGG + Exonic
1055321625 9:75088296-75088318 TCGGGAGCGCGCGCGGCCCGCGG + Intergenic
1056243265 9:84669851-84669873 TCACGCCCGCCGGCGGCGCCTGG - Exonic
1057489562 9:95510851-95510873 GCGCGCGCGCGCCCGGCTCCCGG + Intronic
1057494881 9:95553154-95553176 TCGTGCGCGTCCACTGCCCCTGG - Intergenic
1058908186 9:109498148-109498170 CCGAGCGCGACCCCGGCCCCCGG + Intronic
1060147942 9:121268227-121268249 AGGCGCGCGGCCCCGGCCCCGGG + Intronic
1060952265 9:127612017-127612039 CCGCGCGCGCCCGGGGCGCAGGG - Intergenic
1061264322 9:129496721-129496743 TGGCGGGCGCGGGCGGCCCCGGG - Intergenic
1062272156 9:135714511-135714533 TCGCGGACGCGCGCAGCCCCCGG - Intronic
1062272235 9:135714808-135714830 CCGCGCGCCCCCGCAGCCGCCGG + Intronic
1062472530 9:136712736-136712758 CGGTGCGCGCCCGCCGCCCCCGG + Intronic
1062543335 9:137051156-137051178 GCGTGGGCGCCCTCGGCCCCTGG - Intronic
1062579227 9:137222150-137222172 ACGCCCGCGCCCGCGCCCCTCGG - Intergenic
1062596546 9:137302337-137302359 ACGCGCGCGCCGGCGGCCCCGGG + Intergenic
1203469175 Un_GL000220v1:108727-108749 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203471485 Un_GL000220v1:116898-116920 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1203472856 Un_GL000220v1:124204-124226 TGGCGCGTGCCCGCGGTCCCAGG - Intergenic
1203476996 Un_GL000220v1:152699-152721 GCGCGCGCGCGCGTGGCCGCCGG + Intergenic
1203479306 Un_GL000220v1:160870-160892 CCGCGCGGAACCGCGGCCCCGGG - Intergenic
1185445384 X:255123-255145 GAGCTCTCGCCCGCGGCCCCAGG - Intergenic
1187067453 X:15854693-15854715 TCCGCCGCGCCCGCGGCCCGCGG - Exonic
1189331011 X:40145277-40145299 CCGCGCGAACCCGCGGCGCCCGG + Intronic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1192495999 X:71616967-71616989 TCACGCGGGCCGGGGGCCCCCGG + Exonic
1198276361 X:135098542-135098564 TCGCGCTCGGCGGCGGCCCGAGG - Intergenic
1200418259 Y:2935454-2935476 CCGCGTGCCCCCGCGGCCGCGGG + Intronic