ID: 1192282040

View in Genome Browser
Species Human (GRCh38)
Location X:69697899-69697921
Sequence AGTTATTAGCAGAAGAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 1, 2: 5, 3: 23, 4: 298}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192282040_1192282044 21 Left 1192282040 X:69697899-69697921 CCCACTCTCTTCTGCTAATAACT 0: 1
1: 1
2: 5
3: 23
4: 298
Right 1192282044 X:69697943-69697965 GATAAATTGCCGCATGCATTTGG 0: 1
1: 3
2: 9
3: 10
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192282040 Original CRISPR AGTTATTAGCAGAAGAGAGT GGG (reversed) Intronic
903939613 1:26920591-26920613 AGGTAGCAGCAGAAGAAAGTGGG + Intronic
904354431 1:29929938-29929960 ATTTATTTGCAGAAGAAACTGGG + Intergenic
906035581 1:42748501-42748523 AGTTCTTGGCAGAAGTGAGCAGG + Intronic
906760935 1:48377885-48377907 AGTTATTGGCAATAGAAAGTAGG + Intronic
907861496 1:58358026-58358048 AGGTCTTAGCAGCAGGGAGTGGG - Intronic
908566483 1:65362118-65362140 TGATATTAGGAGAAGAAAGTGGG + Intronic
909196828 1:72637321-72637343 AGTTCTTAAAAGAAGAAAGTAGG - Intergenic
910364599 1:86451091-86451113 AGTTATTAGCAGTTGAAAGAAGG + Intronic
910851147 1:91650958-91650980 AGTTCTGAGCAGAAAAGAGCAGG + Intergenic
911509192 1:98790975-98790997 AATTCTTGGCAGAAGAGAGTGGG + Intergenic
912917492 1:113830406-113830428 ATTTATTTGTTGAAGAGAGTGGG - Intronic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916285315 1:163099526-163099548 AGTTATTTGCAGAAGATCGGAGG - Intergenic
916844349 1:168633177-168633199 AGTTAGTGGCAGAACAGAATTGG + Intergenic
917129911 1:171730664-171730686 AGTTAGTAACAAAAGAGAGAGGG + Intronic
918731268 1:188000561-188000583 AGTTATTAGAAGACTAGAGCTGG - Intergenic
918849547 1:189668710-189668732 TGTTATTAGCATAAGTGATTTGG + Intergenic
919004977 1:191886720-191886742 AGTGACTAGAAGAAGAGTGTTGG + Intergenic
919179820 1:194066337-194066359 AGTAAATAGCAGAAGAGTATGGG - Intergenic
920647247 1:207812647-207812669 AGTTATTAGGAAAAAAGAGGGGG + Intergenic
921194920 1:212746614-212746636 AGTTATAGACAGAATAGAGTTGG - Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
923701065 1:236301072-236301094 AATTCTGGGCAGAAGAGAGTGGG + Intergenic
924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG + Intergenic
1063472305 10:6297893-6297915 AGTCATCAGCAGAAGAGAGACGG - Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1068971685 10:62964676-62964698 AGTTCTTAGCACATGAGACTTGG + Intergenic
1069235992 10:66073992-66074014 AGTGACTAGCAGAAGATAGAAGG - Intronic
1069506869 10:69006857-69006879 AGCTATTAGCAGGAGAGAAAGGG + Intronic
1070051583 10:72895224-72895246 AGTTATTGGCAGCAGATAGGGGG - Intronic
1072161953 10:92776207-92776229 AGTCATTACCAAAAGAAAGTGGG - Intergenic
1072433170 10:95391519-95391541 AGATGTTAGCAGAAGGGAGGGGG - Intronic
1072651841 10:97302127-97302149 TGTTTTTAGCAGCACAGAGTTGG - Intergenic
1073040153 10:100598530-100598552 AATCATTACCTGAAGAGAGTAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1074114330 10:110444192-110444214 AGCTATAAGAAGAAGAGTGTGGG - Intergenic
1075627932 10:123976626-123976648 AGTTTTTAACAGAAGATATTGGG + Intergenic
1077930654 11:6728826-6728848 AGTTTTTAGCAGAACACAGCAGG - Intergenic
1079153080 11:17919254-17919276 GGTTATAAGCAGGAGAGAGAAGG + Intronic
1081148190 11:39591486-39591508 GGTTATTAGTAAAAGAGACTGGG - Intergenic
1081467168 11:43331725-43331747 AGTTTGTATCAGAAGAGAGAGGG + Intronic
1081633710 11:44706616-44706638 TGTTCTTAGAAGAAGAGACTGGG + Intergenic
1081684761 11:45034515-45034537 AGGTGTGAGCAGAAGAGAGGTGG - Intergenic
1082635346 11:55586833-55586855 ACTTATTAGCAGAAGAAGGTGGG + Intergenic
1085061838 11:73454523-73454545 AATTCTTAGCAGAAAAGAGCAGG + Intronic
1085295298 11:75428301-75428323 AGTTATTGGCTGAAGTGAGCAGG - Intronic
1087048262 11:93862565-93862587 ACTTATTAGCAGAAGAGGGTGGG - Intergenic
1088497857 11:110450012-110450034 AGTTACCAGCAGATGGGAGTGGG - Intronic
1089054273 11:115572576-115572598 TGTTTTTAACAGAAGAGACTTGG + Intergenic
1090638638 11:128710898-128710920 AATTTTTAGGAGAAGAGATTTGG + Intronic
1090821627 11:130347672-130347694 AGCTATTTACTGAAGAGAGTAGG + Intergenic
1090949406 11:131459867-131459889 AGTTATTAGCATGACAGAATTGG + Intronic
1091195279 11:133725664-133725686 ATTTAGAAGCAGAAGACAGTTGG - Intergenic
1092217856 12:6695210-6695232 AGTTATGGGCAGCAGAGAATAGG + Intronic
1092938986 12:13390167-13390189 AGTTTTTAGAAGAAGATAGAGGG + Intergenic
1094752903 12:33434400-33434422 ATTTAGTTGCAGAAGAGATTTGG + Intronic
1095509525 12:42935245-42935267 TGTTCTTGGCAGAACAGAGTTGG + Intergenic
1095824811 12:46519873-46519895 TGTTATTATCAGAAGAAATTGGG + Intergenic
1096977759 12:55708941-55708963 AGTTATAAATAGCAGAGAGTTGG - Intronic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1099374421 12:81881325-81881347 GGGGATTAGCAGTAGAGAGTGGG + Intergenic
1099735783 12:86565012-86565034 AGTTATCTGCAGAAGATAGTAGG - Intronic
1099862226 12:88234727-88234749 ACTTATTAGCAGAAGAGGGTGGG + Intergenic
1100727270 12:97421791-97421813 AGTAATAAGCAAAAGAGAGGCGG + Intergenic
1101091485 12:101291177-101291199 ATTTATTATCTGAAGAGACTGGG - Intronic
1102020551 12:109679314-109679336 ACTTATTAGCTGAAGGGACTTGG - Intergenic
1102260364 12:111439699-111439721 AGTTTTGAGCAGAGGAGGGTAGG + Intronic
1104288286 12:127445389-127445411 ACTTATAAGAAGAGGAGAGTAGG - Intergenic
1107009098 13:35650119-35650141 AGGCAATAGCAGAATAGAGTAGG - Intronic
1107129802 13:36883193-36883215 AGTTATCAGGAGATGAGAGTAGG - Intronic
1107797892 13:44073284-44073306 AGTTAATATTAGAAGACAGTGGG - Intergenic
1108272361 13:48774022-48774044 ATGTATTAGCAGAATAGACTAGG + Intergenic
1108479187 13:50850316-50850338 TGTTCTTAGCAAAAGTGAGTAGG - Intergenic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110514708 13:76396323-76396345 AGGTATTGGAAGAATAGAGTTGG + Intergenic
1112564147 13:100537941-100537963 AGGTAAGAGGAGAAGAGAGTTGG + Intronic
1113626173 13:111848861-111848883 TGCTATTAGCAGAAGATAGCTGG - Intergenic
1114033638 14:18598911-18598933 ATTTATCTGCAAAAGAGAGTAGG + Intergenic
1114078429 14:19178091-19178113 ATTTATCTGCAAAAGAGAGTAGG + Intergenic
1114125061 14:19716438-19716460 ATTTATCTGCAAAAGAGAGTAGG - Intergenic
1114990201 14:28277156-28277178 AGCTATTAGCACAGGAGAATTGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1117377106 14:55127017-55127039 AGTTAGAGCCAGAAGAGAGTAGG - Intronic
1118020223 14:61704544-61704566 ACTTGTTAGCAGAGGAAAGTTGG + Intronic
1118406764 14:65432108-65432130 AGTTATAAGGAGAAGGGAGGAGG - Intronic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1122259463 14:100504348-100504370 AGTTATAAGAAAAAGAAAGTAGG - Intronic
1123162247 14:106289578-106289600 GGTTTTTATCAGCAGAGAGTGGG + Intergenic
1123914995 15:25015571-25015593 AGAAATTAACAGAAGAGAGGAGG - Intergenic
1124042424 15:26117763-26117785 TGTCATTGGCAGAAGTGAGTGGG + Intergenic
1124796360 15:32784646-32784668 AGTAATAAGCAGAAGAGAGTGGG - Intronic
1125060370 15:35413597-35413619 AGATATTAGCAAAAGAAAGCTGG - Intronic
1125451173 15:39809189-39809211 TCTTAATAGCAGAAGAGATTAGG - Intronic
1125544362 15:40491484-40491506 AGTGGTTAACAGCAGAGAGTGGG + Intergenic
1129967989 15:79753844-79753866 ACTTATTAGCAGAAGACCTTGGG - Intergenic
1130428556 15:83823285-83823307 TGTTATGAGCAGAATAGGGTAGG - Intronic
1137070791 16:35903118-35903140 ACTTATTAGCAGAAGAGAGTGGG - Intergenic
1137424886 16:48370039-48370061 ATTGAATAGCAGAAGACAGTGGG - Intronic
1140121327 16:72085367-72085389 ATTTATTAGAAGGAGAGGGTAGG - Exonic
1140589497 16:76335044-76335066 CTTTATTCACAGAAGAGAGTTGG + Intronic
1143050118 17:4118377-4118399 AGTTATCTGCAAAAGATAGTAGG + Intronic
1145765368 17:27455668-27455690 AGTTATTTGATGAGGAGAGTCGG + Intergenic
1145944942 17:28766746-28766768 ACTCATTCGAAGAAGAGAGTAGG + Intronic
1149159208 17:53670005-53670027 AGGTATTAGCAGAGCAGAATAGG + Intergenic
1149383499 17:56118815-56118837 TGTTATGAGCAAAAGAGATTTGG + Intronic
1151181868 17:72334922-72334944 AGCCAATAGCAGAAGAGAGCTGG + Intergenic
1154462152 18:14602671-14602693 AGCCATAAGCAAAAGAGAGTTGG + Intergenic
1155657565 18:28209695-28209717 ACTTATTAGCAGAAAAAGGTGGG - Intergenic
1155963388 18:32014591-32014613 AGTCACTAGCAAAAGAGAATGGG - Intergenic
1156003268 18:32410217-32410239 AGTTACTGGAAGCAGAGAGTTGG - Intronic
1156228334 18:35130560-35130582 AATTATTAGAAGGAGAGAGGAGG + Intronic
1156755386 18:40517597-40517619 AGTTTTTAACAGAATGGAGTTGG + Intergenic
1157053800 18:44200387-44200409 CCTTATAAGCAGAAGAGATTGGG + Intergenic
1158121262 18:54050593-54050615 AGTGATAAGAGGAAGAGAGTGGG + Intergenic
1158432432 18:57401420-57401442 AGTTATTATAAGAAGTAAGTGGG + Intergenic
1158678989 18:59549589-59549611 AGGTATTAACAGAAGTCAGTGGG - Intronic
1158771828 18:60527816-60527838 TGTTATTAGAAGAAGAAACTGGG - Intergenic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1160454165 18:78986232-78986254 TGTTTTAAGCAGAAGACAGTTGG + Intronic
1162615788 19:11799054-11799076 AATTTTTAGCAGAAGAAAGGCGG - Intronic
1162962669 19:14137026-14137048 AGTGATTGGCAGGAGGGAGTGGG + Intergenic
1164237523 19:23350124-23350146 ACTTATTAGCAGAAAAAGGTGGG + Intronic
1166626268 19:44358896-44358918 AATTATTAGCAGAAGCGTATAGG + Intronic
926278618 2:11425739-11425761 ACTTATTAGCAGAAGAGGGTGGG + Intergenic
928665172 2:33543676-33543698 AATTATTATCAGAGGAGAGAAGG + Intronic
931350748 2:61486115-61486137 AGTTTTTAGCAAAAGAAAGCAGG + Intronic
932156944 2:69426583-69426605 AGATATTATAAGAAAAGAGTTGG - Intronic
935183932 2:100714870-100714892 AGTTATTTTCAGAAGATGGTAGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935719724 2:105969330-105969352 ACTTATTAGCAGAAGAAGGTGGG - Intergenic
935805772 2:106746271-106746293 AGTTATTGGCAGAAGGCAGAAGG - Intergenic
938217640 2:129533681-129533703 ATCTCTTGGCAGAAGAGAGTGGG + Intergenic
938547217 2:132345496-132345518 AACTATTAGCAGAAGAGTATAGG - Intergenic
939111279 2:138010765-138010787 AGATATAAGAACAAGAGAGTTGG + Intronic
939452779 2:142395456-142395478 ATTTCTTACCAGAAGAGATTGGG - Intergenic
939768876 2:146289707-146289729 AGTTATTATCAGATGAGATCAGG + Intergenic
941191261 2:162385701-162385723 AGTTATTAGCAGAAACCAGATGG - Intronic
942164580 2:173229795-173229817 AGTTTTTAGGGGAAGAGATTGGG + Intronic
942666048 2:178319076-178319098 AGTAAATAGCAGATGAGGGTTGG + Intronic
942783951 2:179678233-179678255 AGTTATTGGCACAGGAGCGTAGG - Intronic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
944122027 2:196250817-196250839 AGTAGTTAGGAGAAGAGAGAGGG - Intronic
944454472 2:199878856-199878878 AATTCTTAGCAGAAGAGGGTGGG - Intergenic
946635509 2:221720987-221721009 AGTGATTATCAGAAGAGAGCAGG - Intergenic
947394998 2:229677559-229677581 ATTTATGAAAAGAAGAGAGTGGG - Intronic
1169843490 20:9965131-9965153 AGTTGTTAGCAGAGGAGATGAGG + Intergenic
1169915103 20:10675314-10675336 AGTTATGAGCATAAAAGGGTGGG + Intergenic
1170701223 20:18705430-18705452 AGTTAATATGAGAAGAGGGTTGG + Intronic
1170821113 20:19757168-19757190 AGATAGTAGCAGAGGAGACTTGG - Intergenic
1171876088 20:30578255-30578277 AACTATTAGCAGAAGAGTATAGG - Intergenic
1174935614 20:54864957-54864979 AATTTTTAGCAGATGAGATTAGG + Intergenic
1174978519 20:55363310-55363332 AGCTCTTAGCAGAATAGAGCAGG + Intergenic
1175831765 20:61968531-61968553 AGGTGTGAGCAGAAGAGAGGCGG - Intronic
1176918771 21:14660458-14660480 AGTTATTAGAAGAAAACATTGGG - Intergenic
1177919127 21:27128618-27128640 ACCTATTAGCAGAGGAGAGAAGG - Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1180457754 22:15525955-15525977 ATTTATCTGCAAAAGAGAGTAGG + Intergenic
1180727455 22:17956970-17956992 AGATATAAGCAGAAGTGTGTGGG + Intronic
1183992670 22:41608864-41608886 AGTGATAAGCAGGAGTGAGTGGG - Intronic
1184478516 22:44734555-44734577 AGTGATGGGAAGAAGAGAGTGGG + Intronic
951606427 3:24439664-24439686 AGTTAATAGCAAAATAGAGTGGG - Intronic
952510594 3:34050114-34050136 AGTTAATTGAAGAAGAGAGATGG - Intergenic
952781022 3:37098851-37098873 ACACATTAGCAGAAAAGAGTTGG - Intronic
953281916 3:41567037-41567059 AGTTATTAGCAGAATAGTCATGG - Intronic
955559719 3:60175808-60175830 TGATATAAGCAGAAGACAGTGGG + Intronic
956072237 3:65465995-65466017 ATTCAACAGCAGAAGAGAGTGGG - Intronic
956930246 3:74035178-74035200 AATTCAAAGCAGAAGAGAGTAGG + Intergenic
957070575 3:75564762-75564784 AGTTAGGTGCATAAGAGAGTGGG + Intergenic
958494282 3:94823411-94823433 GGTTATAAGGAGAAGATAGTGGG + Intergenic
958531394 3:95336253-95336275 AGCTACTAGCTGAACAGAGTGGG - Intergenic
958824298 3:99011526-99011548 ACTTATCAGGAGAAGAGAATGGG + Intergenic
959442113 3:106390022-106390044 AGTAATCAGCAGAAGAGAAAAGG + Intergenic
960217601 3:115061234-115061256 AGTTTTTAGCAGTAGGCAGTAGG - Intronic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
961487330 3:127226255-127226277 AATAATTAGCTGAAAAGAGTTGG + Intergenic
962957598 3:140280406-140280428 AATTACTGGTAGAAGAGAGTAGG + Intronic
962969043 3:140381946-140381968 AGTTGGTAGCATAAAAGAGTAGG - Intronic
964469132 3:157033108-157033130 AGTCCTGAGCAGAAGAGAGATGG - Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965633053 3:170752810-170752832 AGTGATGAGTAGGAGAGAGTGGG + Intronic
965872821 3:173281025-173281047 GCTTATTAGCAGAAGAGGGTGGG + Intergenic
968242240 3:197100907-197100929 AGTTTTTAGGAGAAGAGATGGGG - Intronic
970477211 4:16435772-16435794 GGTTATTTCCAGAAGAGATTAGG - Intergenic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971108391 4:23553314-23553336 AGTAATTACCTGATGAGAGTGGG - Intergenic
972021777 4:34324584-34324606 AGTTATTGGCCTTAGAGAGTAGG + Intergenic
972204174 4:36751590-36751612 AATTAATAGCATAGGAGAGTGGG - Intergenic
973898927 4:55446674-55446696 AATTATAAGCAGAAGAAAATAGG - Intronic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974328490 4:60445757-60445779 AGTTATAAACAGAAGATTGTGGG - Intergenic
975821912 4:78279360-78279382 AGTTTTGAGCAGAAGAGCGCTGG + Intronic
976031411 4:80758566-80758588 AATTCTGGGCAGAAGAGAGTGGG - Intronic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
976370597 4:84284222-84284244 AGTTAATAGCAGAGCTGAGTTGG + Intergenic
980991979 4:139745962-139745984 ATTTAGTAGCAGGAGAAAGTTGG - Intronic
981214208 4:142144942-142144964 AGATTTCAGCAGAAGAGAGTAGG + Intronic
981543331 4:145868725-145868747 TGTTGTAAGCAGAAGAGACTTGG - Intronic
981886207 4:149675789-149675811 AGTCATTGGCAGGAGAGAGGAGG - Intergenic
982932858 4:161430273-161430295 AGTTATTGGCATTAAAGAGTAGG + Intronic
983285006 4:165728151-165728173 AAGTATGAGCAGAAGAAAGTTGG + Intergenic
984463727 4:180070728-180070750 AGTTATTTGCAGATGAGTTTTGG + Intergenic
984949353 4:184995230-184995252 GGTTGTAAGCAGAAGAGAGGTGG + Intergenic
986504763 5:8438046-8438068 AGTTATTTACTGAAGAAAGTGGG - Intergenic
986708776 5:10472403-10472425 AGTGATTTGCCCAAGAGAGTTGG + Intergenic
986865583 5:11982529-11982551 AGTTGTCAGCAGAAAAGAGATGG + Intergenic
988231413 5:28484152-28484174 AATTCTGGGCAGAAGAGAGTGGG - Intergenic
989518677 5:42375167-42375189 AGTTAGCGGCAGAAGAGGGTGGG + Intergenic
990086969 5:51990590-51990612 ACTTATTTGCAGAAGACATTTGG - Intergenic
990363310 5:55043548-55043570 AGTAAATAGCAGAAGAGCATGGG + Intergenic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991138605 5:63213037-63213059 AGATATGGGCAGAAGAGATTGGG + Intergenic
991277817 5:64871414-64871436 AGTTATGAGCAGAAGGGAAGTGG + Intronic
992093208 5:73338033-73338055 AGTGATTAGGAGAAGGGAGAGGG - Intergenic
993203391 5:84847511-84847533 AGTTATCTGCAGAAGACAGCAGG - Intergenic
993257401 5:85609578-85609600 AGAAAGTAGCAGAAGAAAGTTGG + Intergenic
993319825 5:86458549-86458571 AGTTATCTGCAGAAGATAGTAGG - Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
995992369 5:118256541-118256563 ACATACTAGTAGAAGAGAGTAGG + Intergenic
996529021 5:124508198-124508220 AGTTATTAACAGAATAGGGGAGG - Intergenic
997566742 5:134893731-134893753 AGTTAGAAGCAGAAGAGGGGGGG + Intronic
999021942 5:148175716-148175738 TGTTATTAGCATTAGAGAGCTGG - Intergenic
999441296 5:151602849-151602871 ACTTAATTGCAAAAGAGAGTGGG + Intergenic
1000448008 5:161348391-161348413 AATGATTAACAGAAGATAGTTGG + Intronic
1000631803 5:163599113-163599135 ATATATTAGAGGAAGAGAGTTGG + Intergenic
1000748540 5:165066156-165066178 AGCTATGAGTAGAAGAGATTTGG + Intergenic
1000967392 5:167674574-167674596 AGTTATAAGCAGTAGAAACTTGG - Intronic
1001838821 5:174855707-174855729 AGTTATTCACAGAAGATAGCAGG - Intergenic
1002360806 5:178669219-178669241 AGTTGAGAGCAGAAGTGAGTGGG - Intergenic
1002365226 5:178704633-178704655 AGTTGTCAACAGAAGAGATTTGG + Intergenic
1002844100 6:931088-931110 AGTGATATGCAGAAGAGAGAAGG + Intergenic
1004848208 6:19669225-19669247 GAGTATTAGCAGAAGAAAGTTGG - Intergenic
1005308987 6:24541332-24541354 TCTTATTAGAAGAAGAGATTAGG - Intergenic
1005493103 6:26364923-26364945 AAATATTAGCAGAATGGAGTAGG - Intergenic
1007192847 6:40034499-40034521 AGGTTTTAACAGAAGAGATTTGG + Intergenic
1008669412 6:53751934-53751956 CTTTATTAGCAGAAGGGAGGAGG + Intergenic
1009318050 6:62248224-62248246 AGTTACTAACACAAGAGAATGGG + Intronic
1009789018 6:68376222-68376244 AGTTATTAGCAGCAGAGTACTGG + Intergenic
1010108012 6:72190934-72190956 AGTTATCTGCAGAAGACAGCAGG + Intronic
1010782767 6:79964534-79964556 AGATATTAGCAGCTGGGAGTGGG + Intergenic
1010786681 6:80010605-80010627 CATTGTTATCAGAAGAGAGTTGG + Intronic
1011812040 6:91144037-91144059 AGTTATCAGCAGAAAACAGCTGG + Intergenic
1012001905 6:93664421-93664443 AGATATTTGCAGAAGATAGTAGG - Intergenic
1012098156 6:94993060-94993082 TGTTATTGAAAGAAGAGAGTTGG - Intergenic
1012112421 6:95253713-95253735 AATTATTTGAAGAAGAGACTTGG + Intergenic
1013841274 6:114397304-114397326 AGGTATTTCCAGAAGAGATTAGG - Intergenic
1015466851 6:133557745-133557767 AGTTATCAGCAGAAGACGGCAGG + Intergenic
1015805539 6:137104825-137104847 AGTTATTTCCTGAAGAGGGTAGG - Intergenic
1015806915 6:137118987-137119009 AGTTATTTGCTGAAGAGGGTGGG + Intergenic
1016281210 6:142421123-142421145 AGTTATCTGCAGGGGAGAGTTGG + Intronic
1016292816 6:142542342-142542364 GCTTATTAGCAGAAGAAGGTGGG + Intergenic
1017016032 6:150100192-150100214 ACTTATCAGCAGAAGAAGGTGGG + Intergenic
1017278223 6:152594703-152594725 AGTTTTTTGTACAAGAGAGTTGG - Intronic
1017335592 6:153255774-153255796 AGTTATAAGTAGAAGAGATGGGG + Intergenic
1020623143 7:10543058-10543080 AGATATTAGAAAAAGAGAGAGGG + Intergenic
1021056302 7:16050981-16051003 TTTTATTAGCATAAAAGAGTAGG - Intergenic
1021416804 7:20395817-20395839 ACTAATAAGCAGAAGAAAGTGGG + Intronic
1023355347 7:39361872-39361894 GGTTATTTGCAGAAGTGAGTGGG + Intronic
1023775487 7:43602032-43602054 AGATATTAGAGGAAGAGAGGAGG - Intronic
1024144489 7:46499258-46499280 CCCTACTAGCAGAAGAGAGTGGG + Intergenic
1024374734 7:48624105-48624127 AGTTAATAACAGAGGAGAGCTGG + Intronic
1025524985 7:61794699-61794721 AGTTAGTATCTGAAGATAGTTGG + Intergenic
1025548362 7:62207261-62207283 AGTTAGTATCTGAAGATAGTAGG + Intergenic
1027387364 7:77671828-77671850 AGTTTATAGAAGAAGAGAGCTGG - Intergenic
1028652230 7:93162327-93162349 AATTTTGGGCAGAAGAGAGTGGG - Intergenic
1030070260 7:105692196-105692218 GGTTATTAGCAGAAGGAACTGGG + Intronic
1032712067 7:134469236-134469258 ACTTGTTAGCAGAAGAAGGTGGG + Intergenic
1033200443 7:139363658-139363680 AGTTGTTAGCAGAGGGGAGAGGG + Intronic
1033930832 7:146518789-146518811 AGTTACAAGTAGAAGAGAGTGGG + Intronic
1035139256 7:156740282-156740304 AGTTATTGGCAGCAAAGAGGAGG + Intronic
1037423594 8:18730290-18730312 ACATATTAGCAGATGAGATTTGG - Intronic
1038369114 8:26970042-26970064 AATTATGGGCAGAAGAGGGTGGG - Intergenic
1038407657 8:27334065-27334087 AGATATGAGCAGAAAAAAGTGGG - Intronic
1038841904 8:31191939-31191961 TGTTATTAGAAGAAGACATTAGG + Intergenic
1040127430 8:43753954-43753976 AGTTATTATCTGAAGATATTTGG - Intergenic
1040515105 8:48128129-48128151 AGGTATTTGCAGGAGACAGTGGG - Intergenic
1041399449 8:57426646-57426668 AGTAATTAACACAAGAGGGTGGG - Intergenic
1041916570 8:63145059-63145081 ACTTATTAGCAGAAGAAGGTGGG - Intergenic
1042676748 8:71329860-71329882 AATTATTGGCAGGAAAGAGTGGG + Intronic
1043054242 8:75417519-75417541 AGTTATTATCAGAAGAAACTGGG - Intronic
1043137231 8:76543611-76543633 AGTAATTAGAAGAAGGGAGATGG - Intergenic
1043856892 8:85274592-85274614 ACTTATTAGCAGAAGAAGGTGGG - Intronic
1044241646 8:89894687-89894709 AGTTATTAGCCTTAGGGAGTAGG + Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045800080 8:106092127-106092149 AGTTATTTTCAGAGGTGAGTAGG - Intergenic
1046436524 8:114196507-114196529 AGTTATTTGCAGAAGATGCTAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1048652292 8:136491381-136491403 TGTTATTACCATAAGGGAGTTGG - Intergenic
1048867209 8:138769908-138769930 AGCAATTAACAAAAGAGAGTTGG - Intronic
1050274870 9:3986201-3986223 AGGTATTAGCAGAAGACAGAGGG - Intronic
1050694315 9:8261886-8261908 AGTAATTAGGAGTAGAGAGGAGG + Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1050990848 9:12149700-12149722 AATTCTGGGCAGAAGAGAGTAGG - Intergenic
1051000608 9:12277863-12277885 AGGTATTAGCAGAAGAAATAAGG + Intergenic
1052993620 9:34537468-34537490 AGTTGTGAGGAGAAGAGGGTGGG - Intergenic
1053189135 9:36046626-36046648 AGTTATTACCAGAAGACTTTAGG + Intronic
1053868851 9:42469421-42469443 AGTTATTCGCAGAAGATGGCAGG - Intergenic
1054087439 9:60759759-60759781 AGTTATTCGCAGAAGATGGCAGG + Intergenic
1054805483 9:69392825-69392847 AGTTTTCAGCAGAAGAGTGATGG + Intergenic
1055240831 9:74183700-74183722 AGTTCTCAGCAGAAGAGGGCAGG - Intergenic
1056112746 9:83411653-83411675 AGTTATTAAATGAAGAGACTCGG - Intronic
1056126619 9:83540926-83540948 AATTATCAGCAGGAAAGAGTGGG + Intergenic
1060303099 9:122387541-122387563 ACTTATAAGAAGAAGAGATTAGG + Intronic
1203770655 EBV:48436-48458 AGGTATAGGCAGAAGACAGTGGG - Intergenic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1189532289 X:41898386-41898408 AGTTATCAACAGAACTGAGTTGG - Intronic
1190138477 X:47818974-47818996 AGATATGAGCAGAAGAGGATAGG + Intergenic
1190526878 X:51337074-51337096 AGTTATTTACAGAAGAAACTAGG - Exonic
1190530502 X:51369479-51369501 AGAAATTAACAGAAGAGAATAGG + Intergenic
1190557620 X:51652298-51652320 AATAATAAGCAAAAGAGAGTAGG - Intergenic
1191583526 X:62792958-62792980 AGTTATTATCACAAGATATTTGG + Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1191932924 X:66394130-66394152 AGTTATCTGCAGAAGACAGCAGG - Intergenic
1192282040 X:69697899-69697921 AGTTATTAGCAGAAGAGAGTGGG - Intronic
1193276930 X:79600466-79600488 AATTATTAGAAGAAGAAAGAAGG - Intergenic
1193356253 X:80523093-80523115 AGTTATCTGCAGAAGACAGTAGG - Intergenic
1195226368 X:102798654-102798676 AGTTATTGGCATAAATGAGTGGG - Intergenic
1195722510 X:107879678-107879700 AATTCTGGGCAGAAGAGAGTGGG - Intronic
1195932084 X:110088462-110088484 AGTTATTGGCAAAGGAGAGAAGG + Intronic
1196368906 X:114953493-114953515 AGTTATTAGCATTAAAGAGGAGG + Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197947149 X:131851756-131851778 ACTTATTAGCAGAAGAGGGTGGG - Intergenic
1198817904 X:140612967-140612989 AGTTATTAGCATTAAAGAGGTGG - Intergenic
1199020916 X:142877303-142877325 ATTTATTAACAGAAGAGAAAGGG - Intergenic
1199583754 X:149389252-149389274 AGTAATTAGAAAAAGAGAATTGG + Intergenic
1201508780 Y:14734440-14734462 AATTATGGGCAGAAGAGAGTGGG - Intronic