ID: 1192284932

View in Genome Browser
Species Human (GRCh38)
Location X:69725515-69725537
Sequence GCTTAAGTATGTAAAACTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192284932_1192284933 4 Left 1192284932 X:69725515-69725537 CCTTTAGTTTTACATACTTAAGC 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1192284933 X:69725542-69725564 TATTTTTTGCCATTTGTTTGTGG 0: 1
1: 0
2: 10
3: 92
4: 854

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192284932 Original CRISPR GCTTAAGTATGTAAAACTAA AGG (reversed) Intronic
909409774 1:75336530-75336552 GTTTACGTATTTAAAACAAAAGG + Intronic
909512605 1:76471741-76471763 ACTGAAGAATGTAAAACAAAAGG - Intronic
909554132 1:76933916-76933938 GATTAAGAATGTAAGACAAAGGG - Intronic
909613589 1:77580565-77580587 GCCTAAATATTTAAAACTCATGG + Intronic
909649149 1:77953909-77953931 TATTAAGTAGGTAAAAATAAAGG - Intronic
910540360 1:88348745-88348767 TGTTAAGTATGTAAAAATTAGGG - Intergenic
911794410 1:102058384-102058406 GCTGAAGTATGTAAACCTCCTGG - Intergenic
912466685 1:109879426-109879448 GCTTAAGCATGGAAAACTTGGGG + Intergenic
921880811 1:220252808-220252830 GCTGTAGTATGTAAAACTCATGG - Intronic
924003310 1:239578038-239578060 CCTCAAGAATGGAAAACTAATGG + Intronic
924402967 1:243707945-243707967 GCTTAAGTTTTTAAAACTGAAGG + Intronic
924408715 1:243780464-243780486 ACTTAAGTATATAAGACTAAAGG + Intronic
924485312 1:244477307-244477329 GCTGAAGTAAATAAAATTAAAGG + Intronic
924856554 1:247880275-247880297 TCTTAAGTTTGTAAACATAATGG + Intergenic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1064828697 10:19436611-19436633 GATGGAGTCTGTAAAACTAAAGG - Intronic
1065418054 10:25510405-25510427 GCTAAAATAAGTAAAACTAAGGG - Intronic
1066706291 10:38182639-38182661 TCCTGAGTAGGTAAAACTAAAGG - Intergenic
1066805158 10:39241745-39241767 GCTTAACTCTGTAAGACGAATGG - Intergenic
1066983662 10:42443421-42443443 TCCTGAGTAGGTAAAACTAAAGG + Intergenic
1067394231 10:45898462-45898484 TCTTCAGTGTGTAAAGCTAATGG - Intergenic
1067862557 10:49867593-49867615 TCTTCAGTGTGTAAAGCTAATGG - Intronic
1068129684 10:52882075-52882097 GCTTAAGTATTCAGAACTAGAGG + Intergenic
1069668272 10:70179699-70179721 ACTGAAGTCTGTAAGACTAAAGG + Intergenic
1069759549 10:70799200-70799222 GCTGGAGTATGTAAAACTCCTGG + Intergenic
1072337247 10:94408408-94408430 GGTTGAGTAGGAAAAACTAAAGG + Intronic
1073894143 10:108134784-108134806 ACAGAAGTCTGTAAAACTAAAGG + Intergenic
1073998110 10:109339305-109339327 GCTTAAGTAAGTAAATAAAATGG - Intergenic
1074005604 10:109419960-109419982 GCTTAATTATGTAACACTTCGGG + Intergenic
1078771457 11:14356622-14356644 GCTCAAGTCTGTAAGACTCAAGG + Intronic
1082092685 11:48102724-48102746 TCTTAAGTATTTAAAAATTAGGG - Intronic
1082133002 11:48514091-48514113 GCTGTAGTATATAAAACCAAGGG - Intergenic
1082566430 11:54684649-54684671 GCTGTAGTATATAAAACCAAGGG - Intergenic
1083514533 11:63244280-63244302 GTTTGATTATGTAAAAGTAATGG + Intronic
1085945391 11:81264997-81265019 GCTGAAGTATTTAGAAATAAAGG - Intergenic
1085996788 11:81926680-81926702 GAGTGAGTGTGTAAAACTAAAGG - Intergenic
1087154655 11:94889138-94889160 GCTTAACACTGTAAAACTACTGG - Intergenic
1088398898 11:109400907-109400929 GGTTAAGTATGTACAATCAAAGG - Intergenic
1088666879 11:112102103-112102125 ACTTAAAAACGTAAAACTAAGGG + Intronic
1093053155 12:14527014-14527036 GCTTAAGTCTGTAAGTCTGAAGG - Intronic
1093252821 12:16828866-16828888 GGATAAGGATGTAAAAATAAAGG + Intergenic
1093310652 12:17578293-17578315 GCTTATGTATTTAAAACTATGGG + Intergenic
1093514519 12:19970683-19970705 ATTTCAGTATGCAAAACTAAAGG - Intergenic
1095504109 12:42874191-42874213 TCTTAAGTATATTATACTAAGGG - Intergenic
1095882107 12:47148739-47148761 GAATAAATTTGTAAAACTAAGGG - Intronic
1096879678 12:54657717-54657739 GGTTAAGTGTGTTAATCTAAAGG + Intergenic
1098300238 12:69046931-69046953 GGTTAAGTATGTAAAACAGCAGG - Intergenic
1099231711 12:80034099-80034121 GCTTAAATATGAAGAATTAATGG + Intergenic
1099617423 12:84955012-84955034 TATTAAGATTGTAAAACTAATGG + Intergenic
1100618757 12:96251554-96251576 AGTTAAGTATGTAAATGTAAAGG + Intronic
1106906075 13:34410153-34410175 GCTCAAATTTGCAAAACTAAAGG - Intergenic
1107365856 13:39674506-39674528 GCCTAAGTATTTAAAATAAACGG - Intronic
1108430578 13:50349175-50349197 GCTTAGGTCTCTAAAACTGAGGG + Intronic
1111537654 13:89625057-89625079 GCTTGTGTATGGAAAAATAATGG - Intergenic
1111615601 13:90658601-90658623 GCTAGAGTATGTAAAACTCTTGG - Intergenic
1111763218 13:92492961-92492983 ACTTCAGTATGTCAAACAAATGG + Intronic
1111791378 13:92860166-92860188 GATAAATTATGTAAAAATAATGG - Intronic
1111837725 13:93409617-93409639 GCTGAAGTATGAACAACAAAAGG - Intronic
1112488137 13:99838188-99838210 GCTTTTATATTTAAAACTAAGGG + Intronic
1112870656 13:103966751-103966773 GCTTAATATTATAAAACTAAAGG - Intergenic
1113410494 13:110082835-110082857 GCTTAAGCAGGTAAAACATAAGG + Intergenic
1115135653 14:30104661-30104683 GCATAAGTATATTGAACTAAAGG + Intronic
1118196577 14:63632201-63632223 GCTTATATGAGTAAAACTAAGGG - Intronic
1118276764 14:64392447-64392469 GCTTAATTATAGCAAACTAAGGG - Intronic
1119445588 14:74660822-74660844 GCTTAAATATGAAAATCAAAAGG + Intronic
1121206211 14:92170374-92170396 ACTTAAGTATTTAGTACTAATGG - Exonic
1123140228 14:106069640-106069662 GCTTAAGTTTGGAAAACCATAGG - Intergenic
1125901449 15:43351925-43351947 GCTTAAATATGTAACACTCTGGG - Exonic
1127625181 15:60773395-60773417 ACTGAAGTATGTAGAGCTAAAGG - Intronic
1127745290 15:61963743-61963765 GCTAAAGAATGTACAAATAAAGG - Intronic
1129140184 15:73590785-73590807 AATCAAGTCTGTAAAACTAATGG + Intronic
1131941770 15:97575014-97575036 ACTGAAATAGGTAAAACTAAAGG - Intergenic
1133480774 16:6168356-6168378 GCTTAAGTATGAACAGCTTAAGG + Intronic
1138906151 16:61336858-61336880 TTTTAATTATGGAAAACTAAAGG + Intergenic
1140645542 16:77025870-77025892 GCTGAAGTATTTGAAAGTAATGG - Intergenic
1141285169 16:82664728-82664750 GGTTTGGTATGTAAAACTGAGGG + Intronic
1144564832 17:16351845-16351867 CCTTAGGAATGTAAAACTCATGG - Intronic
1145949732 17:28806921-28806943 TCTGAAGTAGGGAAAACTAATGG - Intronic
1149024331 17:52008491-52008513 GGTTAAGTATGTTAATTTAATGG + Intronic
1149707988 17:58713000-58713022 GCTTAAGTAGCTAGAACTATAGG - Intronic
1149720520 17:58839485-58839507 ACTGGAGTCTGTAAAACTAAAGG + Intronic
1149954323 17:61030859-61030881 GGTTATGTGTGAAAAACTAAGGG + Intronic
1153460232 18:5325095-5325117 GCTGGAGTATGTAAAACTCCTGG - Intergenic
1155997005 18:32340932-32340954 GCTTAAATATATAAAACAACTGG + Intronic
1156106002 18:33661765-33661787 CCTTAAGTATGCAGAACTGAAGG - Intronic
1156583585 18:38407985-38408007 GCTTTATTATCTAAAACTTAGGG - Intergenic
1157988177 18:52463538-52463560 GCTTAAGAAGGTAAAACAATTGG + Intronic
1158045259 18:53147966-53147988 ACTTAAGTAAGAAGAACTAAAGG - Intronic
1159276501 18:66228809-66228831 TATTAAGTATGTGAAGCTAATGG + Intergenic
1159680131 18:71339127-71339149 CCTTAAGTATTTAGAAATAAAGG - Intergenic
1159691388 18:71492594-71492616 GTTTTAGTTTGCAAAACTAAAGG + Intergenic
1167028433 19:46939717-46939739 ACTGAAGTATTTAAAAGTAAAGG - Intronic
1168052702 19:53841469-53841491 GTCAAAGTATATAAAACTAAGGG + Intergenic
1202634502 1_KI270706v1_random:32368-32390 GCTTCAATATGTAAAACACATGG + Intergenic
925892218 2:8444126-8444148 TCTTAATGATGTAAAAATAATGG + Intergenic
926505546 2:13710278-13710300 GATTAAGTATGTAAAGTTTAAGG + Intergenic
926522928 2:13939644-13939666 GCTTAAATATGTAAATTTAAAGG + Intergenic
927744720 2:25607650-25607672 TCTTAAGTATTCAAAACTGAGGG + Intronic
928350656 2:30550708-30550730 GATTGAGTATGTAAATGTAAAGG - Intronic
931900131 2:66779270-66779292 GCTCAATAATGTAAAAATAAAGG - Intergenic
933436588 2:82257393-82257415 GCTGGAGTATGTAAAACTCCCGG + Intergenic
934510569 2:94937545-94937567 TCTGCAGTATGTAAAGCTAACGG - Intergenic
934548618 2:95240555-95240577 GCTGGAGTATGTAAAACTCCTGG - Intronic
937655923 2:124376238-124376260 GCTTAATTATGTTAAATAAATGG - Intronic
942018787 2:171845638-171845660 GTGTATGTATATAAAACTAAAGG - Intronic
942138522 2:172954091-172954113 GCTGAAGTAGGTAAAACTGGTGG + Intronic
943911234 2:193570710-193570732 TCTAAAGTATGTAGAAATAATGG + Intergenic
943995280 2:194755990-194756012 GGTTTAGTATGTGAAATTAATGG - Intergenic
946261857 2:218499466-218499488 ACTAAAGTATTTAGAACTAAAGG - Intronic
1168992202 20:2104023-2104045 GATTAAGAATGTAAAACGGAGGG - Intronic
1169418349 20:5437677-5437699 GTTTTAGTGTGTAATACTAAAGG - Intergenic
1170183392 20:13559212-13559234 CCTTCAGTATGTTAAATTAAGGG + Intronic
1173477556 20:43372104-43372126 TCCTAAGTATATAAAACTACTGG - Intergenic
1177837057 21:26196265-26196287 GCTGAAATATGTCAGACTAAAGG - Intergenic
1182194810 22:28505675-28505697 GCTGAAGTAGGTAAAACTTCTGG - Intronic
949463552 3:4320282-4320304 ACTGAAGTTTGTAAGACTAAAGG + Intronic
951006679 3:17624316-17624338 GCTTAATTATAAAAAAATAAAGG - Intronic
951340030 3:21474208-21474230 GCTTACGTAGGGAAACCTAAAGG + Intronic
951548702 3:23855454-23855476 GCTTAACTATGTATTAATAACGG - Intronic
955092840 3:55769358-55769380 CCTGAAGAATGTAAAACTACTGG - Intronic
956073155 3:65476121-65476143 CCATAAGTATGTGAAACTAGTGG - Intronic
956651555 3:71509105-71509127 GCTTAAATATGAAAAAATGATGG - Intronic
957601840 3:82346085-82346107 ACTTAATTAAGTTAAACTAAAGG + Intergenic
957824060 3:85417595-85417617 GTTTAATTATTTTAAACTAACGG + Intronic
959120468 3:102226261-102226283 GCTTAGGTGTATAAAATTAATGG + Intronic
964243201 3:154619829-154619851 GCTTAAGTAGGTAAAAAAAGTGG + Intergenic
965528353 3:169745625-169745647 GCTTAAGTATGTACTACTAGAGG - Intergenic
967674997 3:192287225-192287247 GGTTAAGGAAGTAACACTAAGGG - Intronic
971125170 4:23746037-23746059 ACTTAAGCATTTAAAAGTAATGG + Intergenic
976564341 4:86536575-86536597 GATTATGTATCTACAACTAAAGG - Intronic
977231666 4:94458212-94458234 CCTTAATTATGTAAAATTACTGG + Intronic
978672441 4:111266675-111266697 GCTTCAGTATGACAAACTAAAGG - Intergenic
978750815 4:112245075-112245097 GCTTAAGAATCTAAAAATAAAGG - Intronic
979179462 4:117707413-117707435 GCTGGAGTATGTAAAACTCTTGG - Intergenic
980569361 4:134593212-134593234 GCATAATTATATAAAACTAAAGG + Intergenic
980643210 4:135606007-135606029 TATGAAGTTTGTAAAACTAATGG - Intergenic
981684959 4:147443624-147443646 GCTTAGGTATCTAAACCCAAAGG + Intergenic
982262696 4:153508968-153508990 ACTTAAGTAAGTTAAACAAATGG + Intronic
984427985 4:179612582-179612604 GCTCAAGGAAGTAAAACAAATGG + Intergenic
986780006 5:11056619-11056641 GCTTAAGTATTTTAAATTCATGG + Intronic
989094601 5:37770165-37770187 GCTTCAATATGTAAAATTGAAGG - Intergenic
990315039 5:54575819-54575841 GGTGAAGGATGTAAAACTAATGG - Intergenic
991143533 5:63274216-63274238 GCTGAAGTATGTAAAGCTCCTGG + Intergenic
991145616 5:63299756-63299778 CCTTAAAAATGGAAAACTAAGGG - Intergenic
991927304 5:71718442-71718464 GATTAAGTATGTCAAACTCCTGG - Intergenic
994258200 5:97625879-97625901 GCTCATATAGGTAAAACTAATGG + Intergenic
994505362 5:100636891-100636913 TCTTAAGTCTATAAAACTACTGG - Intergenic
995420990 5:111966713-111966735 GCTTAAGTATATAAAGTAAAAGG - Intronic
995700278 5:114928307-114928329 ACATAAGTATGCAAAAGTAAAGG + Intergenic
997243139 5:132323054-132323076 GCTTAAATATGAAAAAGCAAAGG - Intronic
998023350 5:138790244-138790266 TTTTCAGTAGGTAAAACTAAGGG + Intronic
1000851332 5:166343352-166343374 GCTCCAGTATGTAAAACTCCAGG + Intergenic
1000969638 5:167699362-167699384 GGTTTAGTGTCTAAAACTAAAGG + Intronic
1010870983 6:81038835-81038857 TCTGAAGTATGTACTACTAAAGG - Intergenic
1011636899 6:89382937-89382959 GATTAAGCATTAAAAACTAAAGG + Intronic
1011920938 6:92577008-92577030 GCTGGAGTATGTAAAACTCCTGG - Intergenic
1012142583 6:95642586-95642608 GGTGAAGTATGTAAAACTCCTGG - Intergenic
1013352141 6:109315465-109315487 GCATTAGCATGTAAAACTACAGG + Intergenic
1014398023 6:120950787-120950809 TCTTAAGTATGTGAAACCAGGGG - Intergenic
1015873607 6:137801026-137801048 GCTGAACTATGAAAAACTCAAGG - Intergenic
1016354561 6:143204078-143204100 GTTTAAAAATGCAAAACTAAAGG + Intronic
1016426814 6:143943930-143943952 GCTTAAGGATGACAAACTCAGGG - Intronic
1018286635 6:162247004-162247026 TCTATAGTATGTATAACTAAAGG - Intronic
1020866970 7:13577444-13577466 GCTGAAGTAGGAAAAACAAAAGG + Intergenic
1021016089 7:15536131-15536153 GCTTAAATGAGTAAAACTTAGGG - Intronic
1027750699 7:82141398-82141420 CCTTAAGTGGGTAAAATTAAAGG + Intronic
1028283655 7:88967054-88967076 GCATATGTAAGTAAAATTAAAGG - Intronic
1035306015 7:157932149-157932171 ACTGAAGTATTTAGAACTAAGGG - Intronic
1035878276 8:3215482-3215504 TCATAAGAATGTAAAACTCAAGG + Intronic
1037138291 8:15490061-15490083 CCTTAAGTATGTAAAACAGAAGG + Intronic
1037296867 8:17411121-17411143 CCTTAAAAATGTAAAACAAAAGG + Intronic
1039000431 8:32973708-32973730 GGCTAAGGATGTAAAACTAGGGG + Intergenic
1039095766 8:33883251-33883273 CCTTAAGTACATAACACTAAGGG + Intergenic
1039208551 8:35184853-35184875 GCTAAATTATTTAAAACTCATGG - Intergenic
1041625641 8:60023346-60023368 GCTTAATCATGAAAAAATAAGGG - Intergenic
1042035176 8:64525292-64525314 GCTTAAGTAAGTGAAACGTAGGG + Intergenic
1042826175 8:72982070-72982092 CTTTAACTATGTAAAAATAATGG - Intergenic
1043710773 8:83415513-83415535 ACTTGAGTTTGTAAAACTAAAGG - Intergenic
1044018422 8:87074466-87074488 GCTGGAGTATGTAAAACTCCAGG + Intronic
1044067574 8:87718086-87718108 GAATAAGTATATAAAACTGAAGG + Intergenic
1044117290 8:88350623-88350645 GCTAGAGTATGTAAAACTTCTGG + Intergenic
1044832735 8:96266103-96266125 GCTTGAGTTTTTTAAACTAAAGG - Intronic
1045035284 8:98171879-98171901 GCTTCAGTATGTGAATCTTAGGG + Intergenic
1046497537 8:115034646-115034668 GATTAAGTAAATAAAAATAAAGG - Intergenic
1046561505 8:115843461-115843483 ACTGAAGTATTTATAACTAATGG - Intergenic
1048850240 8:138638335-138638357 GCTTAAGAATGCAAAGTTAAGGG - Intronic
1050394584 9:5181608-5181630 GCTTAATTATATAAAAGTTAAGG + Intronic
1051540393 9:18209520-18209542 GCTTAATTTTATAAAGCTAAAGG + Intergenic
1052130118 9:24834312-24834334 GCTGAACTTTGTATAACTAAAGG - Intergenic
1053654826 9:40206792-40206814 TCTGCAGTATGTAAAGCTAACGG + Intergenic
1054366941 9:64353008-64353030 TCTGCAGTATGTAAAGCTAACGG + Intergenic
1054529772 9:66169523-66169545 TCTGCAGTATGTAAAGCTAACGG - Intergenic
1054674571 9:67842749-67842771 TCTGCAGTATGTAAAGCTAACGG + Intergenic
1055105657 9:72510283-72510305 GCTTAAGTATTTCACACTTAAGG - Intergenic
1055107880 9:72531155-72531177 GTTTAAGTAGGTAAAACTCAAGG - Intronic
1056884794 9:90430931-90430953 GCTTAAGGTTGGAAAACTGAGGG + Intergenic
1059916703 9:119111386-119111408 GCTTAGTTATTTAAAACAAAAGG - Intergenic
1186911885 X:14176082-14176104 ACATAATTATGTAAAAATAAAGG - Intergenic
1187277779 X:17831422-17831444 TTGTAAGTATCTAAAACTAATGG - Intronic
1192046458 X:67679806-67679828 CATCAAGTATGTAAAACCAATGG - Intronic
1192284932 X:69725515-69725537 GCTTAAGTATGTAAAACTAAAGG - Intronic
1192897444 X:75459201-75459223 GCTGGAGTATGTAAAACTCCTGG - Intronic
1194537298 X:95120287-95120309 GCTGAAGTATGTAAAACTCCTGG + Intergenic
1194728940 X:97431931-97431953 GCCTAAGAAAGTAAAAATAACGG - Intronic
1195563729 X:106317090-106317112 GCTTATGTAAATATAACTAATGG + Intergenic
1196212049 X:113006956-113006978 GGTTAAGTCTGTAAATCTCAGGG + Intergenic
1197290578 X:124652103-124652125 GTTTGATTTTGTAAAACTAATGG - Exonic
1201369899 Y:13252401-13252423 CCTTAAGAATGTAAAAAAAAGGG - Intronic