ID: 1192286457

View in Genome Browser
Species Human (GRCh38)
Location X:69743278-69743300
Sequence CAATTTCTCCAGTGATACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 250}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192286457_1192286462 13 Left 1192286457 X:69743278-69743300 CCCATGTATCACTGGAGAAATTG 0: 1
1: 0
2: 2
3: 11
4: 250
Right 1192286462 X:69743314-69743336 TTATGGTACAGATATGGAAGAGG 0: 1
1: 0
2: 1
3: 32
4: 230
1192286457_1192286460 -4 Left 1192286457 X:69743278-69743300 CCCATGTATCACTGGAGAAATTG 0: 1
1: 0
2: 2
3: 11
4: 250
Right 1192286460 X:69743297-69743319 ATTGTCTAAGGCATTGCTTATGG 0: 1
1: 0
2: 1
3: 7
4: 142
1192286457_1192286461 7 Left 1192286457 X:69743278-69743300 CCCATGTATCACTGGAGAAATTG 0: 1
1: 0
2: 2
3: 11
4: 250
Right 1192286461 X:69743308-69743330 CATTGCTTATGGTACAGATATGG 0: 1
1: 0
2: 4
3: 12
4: 191
1192286457_1192286463 18 Left 1192286457 X:69743278-69743300 CCCATGTATCACTGGAGAAATTG 0: 1
1: 0
2: 2
3: 11
4: 250
Right 1192286463 X:69743319-69743341 GTACAGATATGGAAGAGGACTGG 0: 1
1: 0
2: 0
3: 15
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192286457 Original CRISPR CAATTTCTCCAGTGATACAT GGG (reversed) Intronic
902119994 1:14156078-14156100 TAATTTCTTCATTGACACATTGG + Intergenic
904252121 1:29232546-29232568 CCTTTTCCCCAGTGACACATAGG + Intergenic
905306418 1:37021878-37021900 CAGTTTCCCCACTGATACAAAGG + Intronic
907875274 1:58480457-58480479 CATTTTCTCCAGTCATCCACAGG + Intronic
909124940 1:71656045-71656067 CATTTTCTTCAGTTATAAATGGG - Intronic
909522176 1:76582232-76582254 TAATTTTTCCAGTGACACAATGG + Intronic
911283716 1:95962980-95963002 TAATTTCTTCATTGATACACTGG + Intergenic
911486168 1:98508317-98508339 TAAATTCTCCACTGATCCATTGG - Intergenic
911828590 1:102520708-102520730 CAATTTCTTCAGTGTAAAATGGG - Intergenic
912860205 1:113207356-113207378 CATCTTCTCCAGTGGTACAGGGG + Intergenic
914712918 1:150231878-150231900 CAATTTCCCCATTGACACACAGG + Exonic
914895951 1:151673206-151673228 CAATTTCTCCATTGACCCACTGG + Intronic
915724760 1:158009363-158009385 CAATTTCTTCATTGGTAAATGGG + Intronic
916031488 1:160881227-160881249 CTGTTTCTCCAGTGCTGCATGGG + Exonic
916779853 1:168013570-168013592 CAATTCCTCCTCTGATACACTGG + Intronic
917164319 1:172095255-172095277 CTATTTCTGCAGTGAAACAAAGG + Intronic
917713130 1:177707731-177707753 CAGTTTCCCCATTGATAAATGGG + Intergenic
918762139 1:188423781-188423803 GAATTTATCCAGTAATATATGGG - Intergenic
918910741 1:190565214-190565236 TAATTTGCCAAGTGATACATGGG - Intergenic
921241137 1:213184731-213184753 CAATTTCTTCATTGACCCATTGG + Intronic
924293888 1:242566310-242566332 CAGTTTCTCCAGAGAAGCATAGG + Intergenic
1063074099 10:2697457-2697479 AAATTTCTCAAGAGAAACATAGG - Intergenic
1063588876 10:7377377-7377399 CAATTTTTCCACAGATACAGGGG + Intronic
1065948806 10:30632627-30632649 CATTTCCACCAGTGATAAATGGG - Intergenic
1066140336 10:32499253-32499275 ATATTTCTCCATTTATACATAGG + Intronic
1068158112 10:53227117-53227139 TAATTTCTTCACTGATCCATTGG - Intergenic
1069041361 10:63699029-63699051 CTATTTCCCCATTGCTACATTGG - Intergenic
1069221141 10:65885164-65885186 AAATTTATTCACTGATACATTGG + Intergenic
1069596220 10:69672868-69672890 CTCTTTCTCCAGGCATACATTGG - Intergenic
1070313727 10:75292448-75292470 CATTTGCTCCTGCGATACATTGG + Intergenic
1071332668 10:84575405-84575427 CTATTTCTGCAGTGACACAGAGG + Intergenic
1071907831 10:90194300-90194322 AAATTCCTCCAGTGAGACTTAGG + Intergenic
1072266688 10:93736094-93736116 TAATTTCTTCATTGATCCATTGG - Intergenic
1072879345 10:99209390-99209412 TAATTTCTCCATTGATCAATTGG - Intronic
1073085029 10:100882851-100882873 CAATTTGGCCAGTGATGCATGGG + Intergenic
1074442649 10:113492401-113492423 CAGTTTCTCCAGGGAGACATAGG + Intergenic
1076799201 10:132812804-132812826 CAATCTCTCCACTAATATATGGG + Exonic
1079509901 11:21198659-21198681 ACATTGCTCCAGTGAAACATGGG - Intronic
1079979143 11:27130942-27130964 CAATTTCTAAAGTGTTATATAGG + Intergenic
1081197990 11:40184925-40184947 CAATCTCTCCTGGGATAAATAGG - Intronic
1082591913 11:55021639-55021661 CAATTTCTGAAGGGATACTTTGG - Intergenic
1084370687 11:68740681-68740703 ATACTTCTCAAGTGATACATTGG - Intronic
1085223732 11:74899160-74899182 TAATTTCTTCATTGATCCATGGG - Intronic
1085585690 11:77703058-77703080 CAATTTATTCATTGAAACATTGG + Intronic
1085972902 11:81614884-81614906 TAATTTCTTCATTGATCCATTGG - Intergenic
1086593087 11:88539414-88539436 CAATTTCTCCATATATACAATGG + Intronic
1087231856 11:95675167-95675189 CAACTGCTCCAGTGATATCTGGG + Intergenic
1088021734 11:105128223-105128245 TAATTTCTTCATTGACACATTGG - Intergenic
1088949257 11:114549829-114549851 TCATTTCTCCATTGATACTTTGG - Intronic
1089976806 11:122739405-122739427 CAATTTCTCCACTAATAAAATGG + Intronic
1091579243 12:1771944-1771966 AAACTCCTCCATTGATACATAGG + Intronic
1093750014 12:22787605-22787627 CAAGTTCCCCAGTGATCCCTAGG - Intergenic
1096031449 12:48419343-48419365 CAATTTTTCCAGTCATAAAATGG + Intergenic
1099029310 12:77505581-77505603 CAATTTCTCAATTGAGATATTGG + Intergenic
1099123293 12:78719698-78719720 ACATTTCTCCATAGATACATGGG - Intergenic
1099416508 12:82393981-82394003 TAATTTCTTCATTGACACATTGG + Intronic
1100149408 12:91717419-91717441 CAATTTCTACAGTGTGACCTTGG + Intergenic
1101162293 12:101991084-101991106 TAATTTCTTCATTGATTCATTGG + Intronic
1101208396 12:102512149-102512171 CAGTTTCTCCATTGATAAAATGG - Intergenic
1103745096 12:123117276-123117298 GAATTTCTCCAGTGATCCTACGG + Intronic
1106273133 13:28173923-28173945 CAATTTCTCCTGTGAATCACTGG - Intronic
1107160018 13:37215001-37215023 CACTTTCTCCAGTGAAATATAGG + Intergenic
1107985052 13:45768368-45768390 CAATTTCTCCATTTTGACATGGG + Intergenic
1108866402 13:54928511-54928533 CAATTTAGTCAGAGATACATAGG - Intergenic
1108973552 13:56406429-56406451 TAATTTCTTCATTGATCCATTGG - Intergenic
1109336363 13:61000001-61000023 TAATTTCTTCATTGATCCATTGG + Intergenic
1111002932 13:82208373-82208395 AAATTTCTCTAGTGAGAAATAGG + Intergenic
1111380826 13:87449056-87449078 TAATTTATTCATTGATACATTGG - Intergenic
1111533691 13:89573971-89573993 TAATTTCTTCAGTGCTACAAAGG + Intergenic
1111701386 13:91694196-91694218 CAATTTCCTCAGTGATAAAAAGG + Intronic
1112944350 13:104908506-104908528 GAATTTCTCCATTGACCCATTGG + Intergenic
1113031230 13:105996100-105996122 CAATTTTTTCAGTGTTAAATTGG + Intergenic
1113035735 13:106046657-106046679 CAACTTCTCAAATGCTACATTGG + Intergenic
1113219005 13:108076520-108076542 CAGTTTCTCTAGTGATATTTTGG - Intergenic
1113219689 13:108085499-108085521 CAATTTCTCCACTGACACTAAGG + Intergenic
1114362363 14:21988874-21988896 AAATGTCTCCAGTGAGACTTTGG - Intergenic
1114887159 14:26867573-26867595 CAATTTATGCTGTGTTACATTGG + Intergenic
1116382764 14:44291971-44291993 AAATTTCTTCAGGGATTCATAGG - Intergenic
1116401998 14:44518802-44518824 TAATTTCTTCATTGATTCATTGG + Intergenic
1116691525 14:48112853-48112875 CAATGACTCCAATTATACATAGG + Intergenic
1118430553 14:65715699-65715721 TAATTTCTTCATTGATCCATTGG + Intronic
1120174883 14:81282886-81282908 AAATTTCTCCAGTAAGAAATAGG + Intronic
1121241912 14:92437016-92437038 CAATTTCACCATTCATTCATTGG - Intronic
1122073934 14:99223675-99223697 CATTTTATCCAGTGGTGCATTGG - Intronic
1124887721 15:33702448-33702470 CAACTTGTCCTGTGATAGATCGG - Intronic
1127140943 15:55976205-55976227 CAATTTGTCCAGTTATGCTTTGG - Intronic
1130198866 15:81806973-81806995 CAAATCATCCAGTGATGCATTGG + Intergenic
1130530681 15:84746226-84746248 CAATATCTCCAGAGTTTCATTGG - Intergenic
1131559279 15:93425110-93425132 CAATTTCTCCATTTATAAAATGG + Intergenic
1131681033 15:94723730-94723752 CATTTTCCCCACTCATACATTGG - Intergenic
1131844870 15:96479456-96479478 CAATATCTCTAGTGAAATATTGG + Intergenic
1132200121 15:99946565-99946587 CACTTTCTCCTTTGATTCATTGG + Intergenic
1135283853 16:21176196-21176218 CAATTTCTTCATTGATAAGTAGG - Intronic
1138780699 16:59781578-59781600 CAATTTCTCCTTTGATATCTTGG - Intergenic
1140138862 16:72234601-72234623 GAATTTCCCCAGTGTCACATGGG + Intergenic
1140648310 16:77058735-77058757 AAATTTATCCAGTTATAAATAGG - Intergenic
1143290463 17:5824065-5824087 CAATGTCTCCAATGATACAGAGG + Intronic
1145325433 17:21819283-21819305 TCATTTCTCCATTGATACTTTGG - Intergenic
1146919066 17:36697837-36697859 CAATTTCTTCACTGATAAAATGG - Intergenic
1150499686 17:65638576-65638598 CAATTGCTCAAGTGACCCATAGG + Intronic
1156831295 18:41494754-41494776 CTCTCTCTCCAGTCATACATGGG + Intergenic
1157301105 18:46480026-46480048 AAATTTATCAAGTGATAAATTGG - Intronic
1157395981 18:47341538-47341560 CAAATTCTCCAGTGATGCTGAGG + Intergenic
1158008000 18:52695220-52695242 CAATTTCTTCAGTTATAAAATGG + Intronic
1158483268 18:57841568-57841590 CACTTTCTCCAGCAATACAGAGG - Intergenic
1159434097 18:68393662-68393684 CACTTTCTTCAGTGATGGATGGG + Intergenic
1159638089 18:70830292-70830314 CCATTTCTCCACTGATCCCTGGG + Intergenic
1162154229 19:8665836-8665858 CAATTTCTCCAGACATGCATTGG + Intergenic
1165566470 19:36733454-36733476 TAATTTCTTCACTGATCCATTGG - Intronic
1165674487 19:37709836-37709858 GAATTTCCCCAGTAATACATGGG - Intronic
1166575844 19:43837017-43837039 TAATTTCACAAGTAATACATGGG + Intronic
1168462217 19:56568399-56568421 CAAATCCTACAGTGATAGATGGG - Intronic
928068945 2:28195144-28195166 CATTTTCCCCAGTGCTACATTGG + Intronic
928482947 2:31701607-31701629 TAATTTCTTCATTGATCCATGGG - Intergenic
929265866 2:39918888-39918910 CAATTTCTTCATTGATCCAGTGG + Intergenic
931457186 2:62420001-62420023 CAATTTCTTCATTGACTCATTGG - Intergenic
932299999 2:70660015-70660037 CATTTTCTCCAGTCAGATATTGG + Exonic
935688072 2:105703254-105703276 TAATTTCTTCACTGATCCATTGG - Intergenic
938745150 2:134270985-134271007 CTATTTCTCCATATATACATAGG - Intronic
939256882 2:139755838-139755860 TAATTTCTCCATTGACACAGTGG + Intergenic
940090378 2:149909692-149909714 TAATTTCTCCAGTGATAAATTGG + Intergenic
940909621 2:159198894-159198916 CACTGTCTCCTTTGATACATGGG + Intronic
941313686 2:163966246-163966268 CAATTTCTACATTAATAAATTGG - Intergenic
942224486 2:173803424-173803446 CAATTTCTCCATTTGTAAATGGG + Intergenic
942425908 2:175860386-175860408 CACTTTCTCCAGAGAAACCTGGG - Intergenic
943032246 2:182699875-182699897 CAATTTGTCCAGAGTTAAATTGG + Intergenic
943157136 2:184197130-184197152 CAGTTTCTTCAGTGGAACATAGG - Intergenic
943352238 2:186809290-186809312 TAATTTCTTCACTGATACTTTGG + Intergenic
945351030 2:208780219-208780241 CAATTTTTCCAGTCATCCAATGG + Intronic
945354695 2:208826289-208826311 CAGTATCTCTAGTAATACATTGG - Intronic
945400499 2:209376318-209376340 CAACTCCTCCAGTGATTCCTGGG - Intergenic
945407054 2:209461314-209461336 CAAGTGCTCCAGAGACACATGGG + Intronic
948739785 2:240037289-240037311 TAATTTCTTCATTGATCCATTGG + Intergenic
1170479091 20:16747212-16747234 CAATTTCCCAAGGGATAAATGGG - Intergenic
1173058032 20:39635420-39635442 CTATTTCTCCATTTATTCATTGG - Intergenic
1173179404 20:40792401-40792423 CTATTTCTCTATTGATTCATTGG + Intergenic
1173932529 20:46832732-46832754 CAATTTCTCCAGTTACTCTTTGG - Intergenic
1174179007 20:48663189-48663211 CAGTTTCTCCAGTTTTCCATTGG - Intronic
1174528179 20:51190215-51190237 CAGTTTCTCCAGCGATAAAATGG + Intergenic
1174976710 20:55344073-55344095 CAATTTCTCCAGTCTGCCATCGG + Intergenic
1176970913 21:15264621-15264643 AAATTTCTCCAGAGATGAATGGG + Intergenic
1183045764 22:35218516-35218538 CATTATCTGCAGTGTTACATTGG - Intergenic
1184327824 22:43804222-43804244 TAATTTCTTCATTGATTCATCGG - Intronic
950946329 3:16951666-16951688 CTACTTTTCCAGTAATACATAGG + Intronic
951314715 3:21175585-21175607 TAATTTCTTCATTGACACATTGG + Intergenic
952542198 3:34378233-34378255 CAATGTGTCAAGTGAAACATTGG - Intergenic
954313960 3:49791143-49791165 CAATGTCACCAGTGATTTATGGG - Intronic
956501696 3:69893684-69893706 TAATTTCTCTAGAGATGCATGGG + Intronic
958663677 3:97106254-97106276 CAGTTTATCCAGTGATACTGAGG + Intronic
958737606 3:98027308-98027330 CAATTTCTCAAGAGATCCACCGG + Intronic
960828650 3:121820148-121820170 CAATTGCTCAACTGATACACAGG + Intronic
962016519 3:131446234-131446256 CAAATTCTCAAGTGATAAATAGG + Intergenic
965035202 3:163429339-163429361 AAATTTCTTCATTAATACATTGG - Intergenic
965236631 3:166133133-166133155 TAATTTCTTCATTGATACACTGG + Intergenic
966570549 3:181438241-181438263 GAATTTCTTCAGTCAGACATGGG - Intergenic
967693184 3:192500835-192500857 CAATTTCTCCATTCATAAAATGG - Intronic
969842937 4:9896611-9896633 CCATTTTTCAAATGATACATTGG - Intronic
970517924 4:16851830-16851852 CAATGTCTCCAGTGAGAGAGAGG + Intronic
971016247 4:22492114-22492136 CAATTTTTCCAGTGCTACTGTGG - Intronic
971090935 4:23344782-23344804 AAATTTTACCTGTGATACATAGG + Intergenic
972583557 4:40416420-40416442 CAATTTCTCCCTTGATAAAATGG + Intergenic
973025890 4:45270248-45270270 AAATTTCTTCATTGATCCATTGG - Intergenic
974290940 4:59929413-59929435 CAATTTCTTCATTGATCCACTGG - Intergenic
974364118 4:60923708-60923730 CAATTTGTTCAGTCACACATTGG - Intergenic
974677640 4:65114863-65114885 TAATTTCTTCATTGATCCATTGG - Intergenic
974742653 4:66026355-66026377 TAATTTCTCCATTGACCCATTGG + Intergenic
975234507 4:71976390-71976412 CATCTTCTACAGTGATAAATGGG - Intergenic
976867943 4:89753440-89753462 CAGTCTCTCCAGTGATTTATTGG - Intronic
976931102 4:90567934-90567956 TAATTTCTTCATTGATCCATTGG + Intronic
977321167 4:95518194-95518216 CACTATCCCCAGTGACACATAGG - Intronic
978019948 4:103795736-103795758 CATTTTTTCCAGTTAAACATTGG + Intergenic
978995681 4:115148846-115148868 CAATTTCTCCAGTTATTATTTGG + Intergenic
980181410 4:129406167-129406189 CAAGCCCTCCAGTGATACAGGGG + Intergenic
980721109 4:136696751-136696773 CAATTTCTTCATTGACCCATTGG + Intergenic
981159446 4:141480023-141480045 TAATTTCTTCATTGATCCATTGG + Intergenic
981280559 4:142953771-142953793 TAATTTCTCTAGTGATGCAAAGG - Intergenic
982776270 4:159444610-159444632 CAATTTCTCAAGGGATAAAAAGG + Intergenic
982815937 4:159884711-159884733 CAATTTCTTCTATTATACATAGG + Intergenic
983277972 4:165642018-165642040 CAGTTTCTCCAGTGGCACTTGGG - Intergenic
983841728 4:172465123-172465145 CAATATTTCCAGTGGTGCATGGG + Intronic
984405872 4:179329023-179329045 CTATTTGTCTAGTGATACATTGG - Intergenic
986309472 5:6541567-6541589 AAATGTCTCCAGACATACATTGG + Intergenic
987189537 5:15460997-15461019 TAATTTCTTCATTGATTCATTGG + Intergenic
990297942 5:54421482-54421504 GAATTTCTAAAGTGTTACATTGG - Intergenic
990469816 5:56104992-56105014 CAATTTCTTCAGTTATAAAGAGG + Intronic
991356669 5:65775836-65775858 CAAATTCTCCAGGGATACAAAGG + Intronic
992167494 5:74069043-74069065 CAAGGTCTGCAGTGATAGATAGG - Intergenic
993258091 5:85619225-85619247 CAATTTCTTCAGTTATAAAATGG + Intergenic
994915501 5:105971759-105971781 CAATCTCCCCAGTGGTAAATTGG - Intergenic
994917364 5:105997701-105997723 CAATTTCTTCATTGACTCATTGG + Intergenic
995142097 5:108746556-108746578 GAATTTCTCCATTTATACAAAGG - Intergenic
995168855 5:109082213-109082235 AAATGTCTCCTGTGACACATTGG - Intronic
995457717 5:112369644-112369666 CCATTTCTGCAGTTATACAATGG - Intronic
997192533 5:131951349-131951371 GGATTTTTCCACTGATACATAGG + Exonic
999606238 5:153319881-153319903 CAATTTATACAGTGACAGATGGG - Intergenic
999856671 5:155602218-155602240 CACTTTCTCCAGTGGCACAAAGG + Intergenic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1004846570 6:19649426-19649448 CATTTTTTCCTGTCATACATGGG - Intergenic
1005116181 6:22340089-22340111 CAAATTGTCCAGAGCTACATGGG - Intergenic
1006158610 6:32028818-32028840 ACCTCTCTCCAGTGATACATAGG + Exonic
1006443118 6:34064332-34064354 CAATTTCTTCATTTATAAATTGG - Intronic
1008210856 6:48723741-48723763 TAATTTCTTCATTGATGCATTGG + Intergenic
1009446908 6:63753686-63753708 CAATCCCTCCCTTGATACATGGG + Intronic
1009593451 6:65705105-65705127 CACCTTCTCCAGTGTTATATGGG + Intronic
1009823903 6:68841507-68841529 TAATTTCTCCATTGATTCACTGG - Intronic
1010689727 6:78895245-78895267 CAATTTCTTCTTTGACACATGGG - Intronic
1012335380 6:98048848-98048870 ATATTTCTCCATTTATACATAGG - Intergenic
1012783076 6:103588270-103588292 CAATTTCTTCATTGAGACAGTGG + Intergenic
1013671147 6:112404688-112404710 CACTTTTTCCAGAGATACTTGGG - Intergenic
1014181347 6:118387835-118387857 CAATTTGTGCAATGAAACATAGG - Intergenic
1017396453 6:154005317-154005339 TAATTTCTTCATTGATGCATTGG - Intergenic
1017623463 6:156323979-156324001 TAATTTCTTCATTGATTCATTGG + Intergenic
1018361236 6:163071439-163071461 TAATTTCTTCAGTGATCCACAGG - Intronic
1021529552 7:21629146-21629168 TAATTTCTTCATTGATTCATTGG + Intronic
1021897398 7:25250159-25250181 CAACTTCACCAGTGAGAGATGGG + Intergenic
1023007323 7:35886069-35886091 TAATTTGTCTAGGGATACATAGG + Intronic
1023887553 7:44371057-44371079 TAATTTCTTCATTGATCCATTGG - Intergenic
1026567592 7:71502308-71502330 CACTTTCTCCACTGAGAGATGGG + Intronic
1027501263 7:78954399-78954421 CTATTTTTCCAGTGATTCTTTGG - Intronic
1030087316 7:105827883-105827905 ATATTTCTGCAGTGAAACATAGG + Intronic
1030356273 7:108546430-108546452 CTGGTTCTTCAGTGATACATAGG + Intronic
1031302258 7:120076342-120076364 CAATTTATCCAAAGATCCATAGG - Intergenic
1031507637 7:122606380-122606402 CAACTTCCCCAGGAATACATAGG - Intronic
1031529524 7:122859499-122859521 TAATGGCTCCAGTAATACATAGG + Intronic
1031881325 7:127201953-127201975 CATTTTCTCCAATGGTTCATAGG - Intronic
1032381067 7:131481556-131481578 CAAATTCACCAGTGTTACAAAGG - Intronic
1033836516 7:145319908-145319930 CACTTGCTCCAGTAATATATTGG - Intergenic
1035817165 8:2553668-2553690 CAATAGCTCCAGTGATAACTAGG + Intergenic
1037477941 8:19276023-19276045 CAATTTCTCCATTCAGACACTGG + Intergenic
1037721244 8:21446069-21446091 GAATTTCTCCAGTGATAAATGGG - Intergenic
1041954488 8:63542451-63542473 TAATGTCTCCAGTTATAAATCGG - Intergenic
1042532344 8:69829041-69829063 CAATCTGTACAGTGATACCTGGG - Intronic
1044441516 8:92230136-92230158 TTCTTTCTCCAGTGATAGATTGG + Intergenic
1044526259 8:93255105-93255127 CAATCTCTCCATTGATTTATAGG - Intergenic
1045321330 8:101083794-101083816 GAATTTCTCCAGGGAAACAATGG + Intergenic
1045585213 8:103527255-103527277 CCAATTCTCCAGTGATACTGAGG - Intronic
1045629607 8:104102823-104102845 CAATCCCTCCAATGACACATGGG + Intronic
1045639814 8:104236309-104236331 CAATTTCTGGAGTAATACTTTGG + Intronic
1046704291 8:117433692-117433714 CAATGTCTCCTGTGATAACTTGG + Intergenic
1047936219 8:129782117-129782139 CAATTTCTTCATTGACCCATTGG - Intronic
1048723228 8:137351835-137351857 TAATTTCTTCATTGATTCATTGG + Intergenic
1050676900 9:8065950-8065972 CAATTCCTCAAGTAATACAAAGG + Intergenic
1051163876 9:14240074-14240096 CAATTTCTCAAATAATACACTGG + Intronic
1052094844 9:24370834-24370856 CAATTTCTTCATTGAAACCTTGG - Intergenic
1055445555 9:76378733-76378755 GAATCTCTACAGTGAAACATGGG + Intergenic
1055758048 9:79575467-79575489 CAATTTCTGTAGTGTTATATTGG + Intronic
1058119487 9:101123375-101123397 TAATGTGTCCAGTGATAGATGGG + Intronic
1059135326 9:111801016-111801038 CAATTTGCCCAGAAATACATAGG + Intergenic
1059693981 9:116713398-116713420 CAACTTCACCATTGATACATTGG - Intronic
1060140161 9:121202391-121202413 CAGTTTCTCCATGGATACAATGG - Intronic
1186777633 X:12881631-12881653 AAATTTCTGCAGTGACATATAGG - Intronic
1188271421 X:28146281-28146303 CAATTTGTCCAGTTATATCTGGG - Intergenic
1190362934 X:49666302-49666324 CAACTTCTCCAGTGAAAAAATGG - Intergenic
1192286457 X:69743278-69743300 CAATTTCTCCAGTGATACATGGG - Intronic
1192378446 X:70588324-70588346 CAATCTCTCCCTTAATACATGGG - Intronic
1192932761 X:75825415-75825437 CAATTTCTCAGATGAGACATTGG - Intergenic
1193041943 X:77013391-77013413 CAATCTCTGCAGTGAGACACTGG - Intergenic
1193712706 X:84897760-84897782 CAATTTCACCAGGGATTAATGGG + Intergenic
1195300568 X:103525908-103525930 AGACTTATCCAGTGATACATTGG + Intergenic
1195592424 X:106645494-106645516 TAATTTCTTCATTGACACATTGG + Intronic
1197139529 X:123101384-123101406 TAATTTCTTCATTGATACACTGG - Intergenic
1197324761 X:125078998-125079020 CAAGTTCTCCAGAGTTACACAGG + Intergenic
1197437605 X:126451897-126451919 GAGTTTCTCCTGTGACACATGGG - Intergenic
1198992283 X:142528496-142528518 CAATTTCTCCAGCCATATTTGGG - Intergenic