ID: 1192287613

View in Genome Browser
Species Human (GRCh38)
Location X:69755335-69755357
Sequence GGTGATACCCTGGCAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192287613_1192287618 13 Left 1192287613 X:69755335-69755357 CCTGTTTTTGCCAGGGTATCACC 0: 1
1: 0
2: 1
3: 28
4: 107
Right 1192287618 X:69755371-69755393 GAACAGGAAATATTTTAGAATGG 0: 1
1: 1
2: 10
3: 281
4: 636
1192287613_1192287616 -3 Left 1192287613 X:69755335-69755357 CCTGTTTTTGCCAGGGTATCACC 0: 1
1: 0
2: 1
3: 28
4: 107
Right 1192287616 X:69755355-69755377 ACCAGCAGAGGCTGCAGAACAGG 0: 6
1: 21
2: 17
3: 55
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192287613 Original CRISPR GGTGATACCCTGGCAAAAAC AGG (reversed) Intronic
902131545 1:14265741-14265763 GATGACATCATGGCAAAAACAGG + Intergenic
903389912 1:22956355-22956377 AGTGAGACCCTGCCAAAAAAAGG + Intronic
905921820 1:41724676-41724698 GCTGATACCATGGAAAAAACTGG + Intronic
915062133 1:153194998-153195020 GATGATACACTGCAAAAAACAGG - Intergenic
915400034 1:155615534-155615556 GGTGAAGACCTGGCAAAAAGAGG - Intergenic
915417240 1:155751729-155751751 GGTGAAGACCTGGCAAAAAGAGG - Intronic
919026625 1:192179933-192179955 GTTGTTACACTGGCGAAAACTGG + Intronic
919046037 1:192453531-192453553 AGTGAGTCTCTGGCAAAAACAGG + Intergenic
919366181 1:196664068-196664090 GGTGAGACCCTGTCACAAAAGGG - Intronic
922379927 1:225013267-225013289 GGTGATACCCAGGCAAACAGGGG - Intronic
922664268 1:227455268-227455290 GGTGACATCCTGGGAAGAACAGG + Intergenic
923893537 1:238242289-238242311 AGTGATTCACAGGCAAAAACTGG + Intergenic
924493901 1:244568142-244568164 GGTGATACCCAGGCAAACAGGGG - Intronic
1068552542 10:58423009-58423031 GGTGATACCCAGGAAAAACAGGG - Intergenic
1072401791 10:95110566-95110588 GGTGATACCCAGGAAAAATCTGG - Intergenic
1073950140 10:108798127-108798149 TTTGATAACCTGGCAAATACTGG - Intergenic
1077926434 11:6686193-6686215 AGTGTTACCATGGCAAAAACTGG - Intergenic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1081241350 11:40710493-40710515 GGTGATACCCAGGCAAACAGGGG - Intronic
1082984464 11:59156486-59156508 GGTGATATCTTGGAAAAGACTGG + Intergenic
1083490195 11:63009996-63010018 GGGGATCCCCTGGTAAAAAGGGG - Intronic
1084339839 11:68489611-68489633 GCTGATACCCTGGCAAATACGGG - Intronic
1085691191 11:78665285-78665307 AGTGAGACCCTGTCAAAAAAAGG - Intronic
1086012372 11:82120812-82120834 GCTGATACCCAGGCAAAACAGGG + Intergenic
1086412907 11:86559815-86559837 GGCCATCCCCTGGGAAAAACAGG + Exonic
1086879652 11:92138369-92138391 GGTGACAGACTGGCAAAAAAAGG - Intergenic
1087237269 11:95734074-95734096 GGCTATACCCTGACCAAAACAGG - Intergenic
1088804676 11:113341330-113341352 AATGACAACCTGGCAAAAACTGG - Intronic
1090751579 11:129750658-129750680 GGTGCTAACTTGGCAAGAACAGG + Intergenic
1091578010 12:1757446-1757468 GGTGCTAACCTGGGAAGAACTGG - Intronic
1094387505 12:29910756-29910778 GCTGATACCCAGGCAAAGAGGGG + Intergenic
1101386511 12:104262886-104262908 GGTGATACTATTGCAAACACAGG - Intronic
1105253039 13:18718057-18718079 GGTGATAAACATGCAAAAACAGG + Intergenic
1105737283 13:23284908-23284930 GGTGATATCCAGGCAAACAGGGG - Intronic
1109004400 13:56853043-56853065 GGAGATACCCTGTAAGAAACTGG - Intergenic
1111698381 13:91654821-91654843 GGTGAAACAATGGCAAAAATGGG - Intronic
1115339181 14:32273533-32273555 GGTGATACCCAGGCAAACAGGGG + Intergenic
1115775437 14:36709738-36709760 GGGGATAGCTGGGCAAAAACAGG + Intronic
1116583701 14:46674968-46674990 GGTGAGACCCTGAGAAATACTGG + Intergenic
1116679365 14:47946200-47946222 AGTGAGAACCTGGCAAAAAGGGG + Intergenic
1118360484 14:65052642-65052664 TATGATACCCTAGCAAAAACTGG - Intronic
1122877158 14:104673523-104673545 GGTGATAGTCTGGCAGAAAGAGG + Intergenic
1127011530 15:54636045-54636067 TGTGATTCCCTGGCAATAACTGG - Intergenic
1127339617 15:58027240-58027262 GGTGATACCCAGGCAAACAGTGG + Intronic
1133196074 16:4171502-4171524 TGTGCTCCCCTGCCAAAAACTGG + Intergenic
1133565779 16:6992063-6992085 GGTGAAACTCTGGCAAAGACAGG - Intronic
1137431868 16:48425025-48425047 GGTGAGACCCTGTCTCAAACTGG - Intronic
1139631484 16:68234451-68234473 GGTGGTACCCGGTCAAAGACAGG - Intronic
1140018808 16:71216726-71216748 GATGCTACCCTGGGAAAAACTGG - Intronic
1142596655 17:1033011-1033033 TGTGTAACCCTGGCAAGAACTGG - Intronic
1145916548 17:28577289-28577311 GGGTATACCCTGGCAAATATGGG - Intronic
1147132222 17:38416047-38416069 GGCTATACCCTGGCTACAACCGG - Intergenic
1149437353 17:56644516-56644538 CGAAATACCCTGGAAAAAACAGG + Intergenic
1150445650 17:65225374-65225396 GGTGAGAGCCTGGCAAAGACAGG - Exonic
1155576520 18:27253921-27253943 GGAGATCCTCTGGCAAGAACAGG + Intergenic
1159562287 18:70008097-70008119 GGTGATACCCAGGCAAACAGGGG + Intronic
1165185963 19:34021662-34021684 GGTGCTAACCTGGGAAGAACTGG + Intergenic
926155890 2:10453929-10453951 GGTGAGGCTCTGGCAAAAATGGG - Intergenic
926356809 2:12048275-12048297 AGTGATACCCTGGAAAAGAGGGG + Intergenic
933404462 2:81840794-81840816 GCTGATACCCAGGCAAACATGGG + Intergenic
936342427 2:111646095-111646117 GGTGTTTCCCTGGCATATACTGG + Intergenic
938751797 2:134338672-134338694 CCTGATACCCTGACAAAGACAGG - Intronic
945359811 2:208883731-208883753 TGTAATACCCTTGCAAAAATTGG + Intergenic
946166568 2:217867914-217867936 AGAAATACCCTGGCAAAAAATGG - Intronic
947870067 2:233430239-233430261 AGAGATACACTGGTAAAAACAGG + Intronic
948624262 2:239259067-239259089 GGTGATACGCTGTCAAAGTCAGG - Intronic
1169149169 20:3275761-3275783 GGTGAGACCTTGGCCAAATCTGG - Intronic
1169405114 20:5316019-5316041 GGCGACATCCTGGCAAAGACAGG + Intergenic
1176838546 21:13817939-13817961 GGTGATAAACATGCAAAAACAGG + Intergenic
1176883971 21:14231736-14231758 GGTGATACCCTTGTATAAACAGG - Intergenic
1183626342 22:39004843-39004865 CGTGCTACCCTAGCAAGAACGGG - Intergenic
954490524 3:50900783-50900805 GGTGATACCCAGGCAAACAGGGG - Intronic
958064829 3:88529409-88529431 GGAGAGACCCTGGCTAAAAGAGG - Intergenic
958081182 3:88747744-88747766 GGTGATACACAGGCAAAAAGTGG + Intergenic
959121356 3:102236392-102236414 GATGATAAACTGGCAAACACTGG - Intronic
959692992 3:109219416-109219438 GGTGATACCCAGGCAAACAGGGG + Intergenic
960093411 3:113665104-113665126 GGTGATACCTGAGCAAAAACTGG + Intronic
961174076 3:124819917-124819939 GGTGCTTCCCTGGCAAATGCTGG - Intronic
961357195 3:126346580-126346602 GGTGACACCCTGGGAAGGACAGG + Intronic
963978559 3:151510345-151510367 GCTGATACCCAGGCAAAGAGTGG + Intergenic
964588050 3:158329508-158329530 GCTGATACCCAGGCAAACAGGGG - Intronic
965825262 3:172723258-172723280 AGAGATATCCTGGCAAAAGCAGG + Intergenic
968008443 3:195258157-195258179 TGTGATGCTCTGGCAAAAGCAGG + Intronic
971002779 4:22341239-22341261 GCTGTTTCCCTGGCAAAAAAAGG - Intergenic
971004593 4:22358388-22358410 GGTGATACCCAGGTGAAAAGGGG + Intronic
974523220 4:63012644-63012666 AGTGAGAGCCTGGCCAAAACAGG + Intergenic
975753519 4:77549637-77549659 GGTGATACCCAGGCAAACAGGGG - Intronic
977887980 4:102273787-102273809 GGTGATACCCAGGCAAACAGGGG + Intronic
982579754 4:157162607-157162629 GGTGATACCCAGGCAAACAGGGG - Intronic
982638487 4:157926923-157926945 GGTGATACCCAGGCAAAACAGGG - Intergenic
985548806 5:523125-523147 GGGGAGACCCTGGCATAAATAGG + Intronic
988035720 5:25824870-25824892 GGTGAAACTCTGTCAAAAAAAGG - Intergenic
989027624 5:37085616-37085638 GGTGCTAACCTGGGAATAACTGG + Intergenic
990669484 5:58112050-58112072 TGTGATACTGTAGCAAAAACAGG - Intergenic
994586465 5:101715570-101715592 GGTGATACCCAGGCAAACAGGGG - Intergenic
995183022 5:109246591-109246613 GGAGATAGCCGGGCAGAAACTGG + Intergenic
995230048 5:109750406-109750428 GGTAATACCCTAGGAAAAACAGG + Intronic
1003035764 6:2639156-2639178 GGCGACACCCTGGAAAAAACAGG - Intergenic
1005045785 6:21640967-21640989 GGCGAAACCCTGTCAAAAAAAGG - Intergenic
1005376200 6:25185336-25185358 AGTGATACCCAGGCAAATATAGG - Intergenic
1007081560 6:39108750-39108772 GGAACCACCCTGGCAAAAACGGG - Intronic
1010592523 6:77727086-77727108 GGTGATACCTCCACAAAAACGGG + Intronic
1013484884 6:110587394-110587416 GGTGATAGCCTGACCAAAATGGG + Intergenic
1014176939 6:118341842-118341864 GGTGATACACAGGCAAACAGGGG - Intergenic
1015462000 6:133501967-133501989 GGTTATACACTGGCAACATCTGG + Intronic
1015803970 6:137090074-137090096 GGTGAAAAGCTGACAAAAACAGG - Intergenic
1018014726 6:159701877-159701899 GGTGATCCTCTGGCAAGAAGGGG - Intronic
1019460717 7:1156962-1156984 GGTCAGACCCTGGCCAACACTGG + Intronic
1021655381 7:22869138-22869160 GGTGTGATCCTGGCAAGAACCGG - Intergenic
1024949041 7:54839455-54839477 GGTGATCCCCAGGAGAAAACAGG + Intergenic
1026672313 7:72401064-72401086 GTTGACACCTTAGCAAAAACGGG - Intronic
1033074252 7:138233805-138233827 AGTGAGACCCTGTTAAAAACAGG - Intergenic
1033533093 7:142285853-142285875 GGTGAAACCTTGGAAAACACAGG + Intergenic
1036998620 8:13689836-13689858 AGAGATACCCTGGGAAAAACTGG - Intergenic
1038849977 8:31266242-31266264 TGTGATGCCCTGGGAAAACCAGG - Intergenic
1042250585 8:66752573-66752595 GGAGTTACCCTGTGAAAAACTGG + Intronic
1046214397 8:111124566-111124588 GGTAATACTCTGGCAAACATTGG + Intergenic
1047507222 8:125489371-125489393 GGTTATACACTGGCAACACCTGG - Intergenic
1050138508 9:2493709-2493731 AATGATACCTTGGCAACAACTGG + Intergenic
1051715673 9:19980723-19980745 GGTGATTCCCAGGCTCAAACAGG + Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1053521101 9:38780243-38780265 GCTGATACCCAGGCAAACAGGGG + Intergenic
1054193260 9:62004236-62004258 GCTGATACCCAGGCAAACAGGGG + Intergenic
1054645147 9:67584455-67584477 GCTGATACCCAGGCAAACAGGGG - Intergenic
1056897906 9:90567955-90567977 GATAATACCGTGGCACAAACAGG + Intergenic
1058259906 9:102815221-102815243 GGTGATACCCAGGCTAAACAGGG + Intergenic
1059895203 9:118856286-118856308 GGTGAAACCCCCGCAACAACAGG + Intergenic
1060444013 9:123670859-123670881 TGTGTTACCCTGGCAAACAGGGG + Intronic
1060600012 9:124871024-124871046 ACTGAAACCCTGGCAAATACGGG + Intronic
1188049291 X:25465134-25465156 TGTAATACCCTGAAAAAAACTGG - Intergenic
1188972287 X:36632708-36632730 GGACATACCCTGGCAAAGAGGGG - Intergenic
1189175211 X:38949875-38949897 GGTAATACCCTCCCAAAAACAGG + Intergenic
1190455753 X:50626356-50626378 GATGAAACCCTGTCAAATACAGG - Intronic
1192287613 X:69755335-69755357 GGTGATACCCTGGCAAAAACAGG - Intronic
1201062377 Y:10059006-10059028 GGTGGTGCCCTGCCTAAAACTGG - Intergenic
1202179457 Y:22127100-22127122 GGGGATATCCTGGCAAACTCCGG - Intergenic
1202211904 Y:22459294-22459316 GGGGATATCCTGGCAAACTCCGG + Intergenic