ID: 1192291702

View in Genome Browser
Species Human (GRCh38)
Location X:69803727-69803749
Sequence CTAGTATTCTACACCAATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 1, 2: 10, 3: 96, 4: 403}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192291702 Original CRISPR CTAGTATTCTACACCAATGT AGG (reversed) Intronic
902175003 1:14642612-14642634 CTAGTGTTCTATGCCACTGTAGG + Intronic
902791332 1:18770225-18770247 CAGGTATTCTAGACCAATGTGGG + Intergenic
906911833 1:49960484-49960506 CTAGTGTTCTATACCACTATAGG + Intronic
907024092 1:51098148-51098170 CTAGTGTTCTGTACCACTGTAGG + Intergenic
907261102 1:53219274-53219296 CTAGTGTTCTATAGCACTGTAGG + Intronic
907811830 1:57878743-57878765 CTAGTGTTCTACAGCACTGTTGG - Intronic
908344818 1:63221341-63221363 ATAGTGTTCTATACCACTGTAGG + Intergenic
908395401 1:63720909-63720931 CTAGTGTTCTACAGCACTGTAGG - Intergenic
909588196 1:77314711-77314733 CTAGTGTTCTATGCCACTGTAGG - Intronic
909949565 1:81703886-81703908 CTTGTATTCTACACTAAGGAAGG + Intronic
910045424 1:82908193-82908215 CTAGTGTTCTATAGCACTGTAGG - Intergenic
911266150 1:95746008-95746030 CTGGTGTTCTATACCACTGTAGG - Intergenic
911652781 1:100408912-100408934 CTAGTGTTCCATACCACTGTAGG - Intronic
911837540 1:102640471-102640493 CTAGTATTCAACACTACAGTAGG - Intergenic
912005657 1:104897301-104897323 CTAGTTTTCTATACCACTGAGGG - Intergenic
912620615 1:111153040-111153062 CTAGTGCTCTACAGCAATGTAGG - Intronic
913373369 1:118125444-118125466 CTAGTGTTCTATAGCACTGTAGG - Intronic
914051258 1:144134962-144134984 CTAGTTCTCTACAGCACTGTTGG - Intergenic
914127923 1:144830480-144830502 CTAGTTCTCTACAGCACTGTTGG + Intergenic
915688366 1:157660545-157660567 CTAGTATTCAATAGCAAAGTGGG - Intergenic
915781289 1:158553332-158553354 CTAGTGTTCTATAGCACTGTAGG + Intergenic
915864807 1:159487730-159487752 CTAGCATTCTATAGCACTGTAGG - Intergenic
915985905 1:160464313-160464335 CTAGTGTTCTGTACCACTGTAGG - Intergenic
916063430 1:161117900-161117922 CTAGTATTCCAGACCCAGGTGGG + Intronic
916384694 1:164254490-164254512 CCAGTTCTCTCCACCAATGTTGG - Intergenic
917401752 1:174657313-174657335 CTAGTGTTCTATAGCACTGTAGG - Intronic
918034017 1:180848230-180848252 CTAGTGTTCTATACCACAGTAGG - Intronic
918802103 1:188985599-188985621 CTAGTATTCCAATCAAATGTAGG + Intergenic
919236589 1:194853116-194853138 TTAGTGTTCTATACCATTGTAGG - Intergenic
919446072 1:197707341-197707363 CTAGTGTTCTATAACACTGTAGG + Intronic
919622582 1:199879548-199879570 CTAGTGTTCTATTCCACTGTAGG + Intergenic
921586689 1:216955115-216955137 CTAGTGTTCTATAGCACTGTAGG - Intronic
921817733 1:219582936-219582958 CTAGTATTCTATAGTACTGTAGG - Intergenic
922411470 1:225380031-225380053 TTAGTGTTCTATACCACTGTAGG - Intronic
922414467 1:225408095-225408117 CTAGTATTCTATACCACTGTAGG - Intronic
922843768 1:228666496-228666518 CTAGTGTTCTATATCACTGTAGG - Intergenic
922871898 1:228909442-228909464 CTAGCATTCTATAGCACTGTAGG + Intergenic
923871648 1:238001356-238001378 CTAGTGTTCTATACCACTGTAGG - Intergenic
923995654 1:239491259-239491281 CTAGTGTTCTACAGCACTATAGG - Intronic
924824774 1:247527807-247527829 CTAGTGTTCTATACCACTGCGGG - Intronic
1063149787 10:3325791-3325813 CTAGTGTTCTATAACACTGTAGG + Intergenic
1064587509 10:16853284-16853306 CTTGTATTCTACACAAATATAGG + Intronic
1064947122 10:20803181-20803203 CTAGTGTTCTATACCACTGTAGG + Intronic
1065387189 10:25145387-25145409 CTAGTGTTCTATTCCATTGTAGG - Intergenic
1066760667 10:38748333-38748355 CTAGTTCTCTACAGCACTGTTGG + Intergenic
1066960907 10:42224083-42224105 CTAGTTCTCTACAGCACTGTTGG - Intergenic
1067261268 10:44694253-44694275 CTAGTGTTTTATACCACTGTAGG - Intergenic
1067997180 10:51286757-51286779 CTAGTGTTCTATACCACTGTAGG - Intronic
1068701012 10:60019522-60019544 CTAGTGTTCTATACCACCGTAGG + Intergenic
1068888027 10:62117504-62117526 CTAGTATTATATAGCACTGTAGG - Intergenic
1070235436 10:74620182-74620204 CTAGTGTTCTACAGCAATGTAGG - Intronic
1071938807 10:90563440-90563462 CTAGTTTTCTACAGCACTATAGG - Intergenic
1071956039 10:90760417-90760439 CTAGTGTTCTATAGCATTGTAGG + Intronic
1072347812 10:94526001-94526023 CTAGTGTTCTATAGCACTGTAGG - Intronic
1072375115 10:94806964-94806986 ATAGTATTCTATAGCAGTGTAGG - Intronic
1072890354 10:99317879-99317901 CTAGTGTTGTATACCACTGTAGG + Intergenic
1073702544 10:105945031-105945053 CTAGTATTCTATACTGCTGTAGG - Intergenic
1075745161 10:124722110-124722132 CTAGTGTTCTATAGCACTGTAGG + Intronic
1076922751 10:133463888-133463910 CTAGCATTCTATAGCACTGTAGG - Intergenic
1077759865 11:5082325-5082347 CTAGTGTTCTATAGCATTGTAGG + Intergenic
1077970665 11:7186365-7186387 CTAGTGTTCTACAGCATTATAGG - Intergenic
1078226705 11:9398800-9398822 CTAGTGTTCTATAGCACTGTAGG - Intronic
1078971330 11:16415482-16415504 CTAGTTTTCTACAGCATTGAAGG + Intronic
1079342624 11:19625133-19625155 CTAGTGTTCTATACCACTGTGGG - Intronic
1079455154 11:20630046-20630068 CTAGTATTCTATAGCACTATAGG - Intronic
1079664461 11:23086397-23086419 CTAGTGTTCTTTACCATTGTTGG + Intergenic
1079764855 11:24379616-24379638 CTGGTGTTCTATACCACTGTAGG - Intergenic
1080375588 11:31706318-31706340 CTAGTACTCTATACCACTGTAGG - Intronic
1082069300 11:47925925-47925947 CTAGTGTTTTATACCACTGTAGG - Intergenic
1082627101 11:55499417-55499439 CTAGTGTTCTATGCCACTGTAGG - Intergenic
1082901600 11:58259757-58259779 CTAGTGTTCTACAGCATTATAGG - Intergenic
1082911571 11:58381816-58381838 CTAGTGTTCTATAGCACTGTGGG + Intergenic
1083502475 11:63123028-63123050 ATAGTATTCTATACCACTGTAGG - Intronic
1085670313 11:78458041-78458063 CTGGTATTCTGCAGCAATATAGG + Intronic
1086130625 11:83398092-83398114 CTAGTGTTCTATACTACTGTAGG - Intergenic
1086366530 11:86112379-86112401 CTAGTGTTCTACAGCACTGGAGG - Intergenic
1087185363 11:95186534-95186556 CTAGTGTTCCATACCACTGTAGG + Intronic
1087346190 11:96973852-96973874 CTAGTATTTTACAGCACTGTAGG + Intergenic
1087679690 11:101205715-101205737 CTAGTGTTCTATAGCACTGTAGG - Intergenic
1088571308 11:111226478-111226500 CTAGCTTTCTACACCACTGTAGG + Intergenic
1088705803 11:112463640-112463662 CTAGTATTCTGCACTACTGTAGG - Intergenic
1089532480 11:119139730-119139752 CTAGCATTCTACAGCACAGTAGG - Intergenic
1089955382 11:122566426-122566448 CTAGTGTTCTCTACCATTGTAGG + Intergenic
1091102880 11:132892030-132892052 TTAGTATTCTTCAACACTGTTGG - Intronic
1091934077 12:4421487-4421509 CTAGTATCCTACATCACTGTAGG - Intergenic
1092631675 12:10385679-10385701 CTAGTGTTCTATAGCACTGTAGG + Intronic
1092803360 12:12194790-12194812 TGAGTATTCTATACCACTGTAGG - Intronic
1093206296 12:16254912-16254934 TTAGTGTTCTATACCACTGTAGG + Intronic
1093975557 12:25417173-25417195 CTAATGTTCTACAGCACTGTAGG - Intronic
1095643492 12:44512886-44512908 CTAGTGTTCTATAACACTGTAGG + Intronic
1097475125 12:60045138-60045160 CTAGTATTCTACAGCACTGTAGG - Intergenic
1097520533 12:60664014-60664036 CTAGTGTTCTATAGCACTGTAGG - Intergenic
1097593362 12:61598635-61598657 CTAGGTTTCTACATCATTGTTGG + Intergenic
1098556439 12:71824205-71824227 TCAGTATTCCACAGCAATGTTGG - Intergenic
1099362134 12:81717413-81717435 CTATTATTATCCACCAGTGTTGG - Intronic
1099387519 12:82033517-82033539 CTAGTGTTCTCTACCACTGTTGG - Intergenic
1100118110 12:91334329-91334351 CTAATATTCTAAACCAATCCAGG - Intergenic
1100368787 12:93945990-93946012 ATAATATTCTAAACAAATGTAGG - Intergenic
1102199622 12:111048377-111048399 CTAGCACTCTACAGCATTGTGGG + Intronic
1102716625 12:114979118-114979140 CTAGTGTCCTACAGCATTGTAGG + Intergenic
1102985587 12:117275572-117275594 GTACTGTTCTACACCACTGTAGG + Intronic
1103055177 12:117814184-117814206 CTAATGTTCTATACCACTGTGGG + Intronic
1103135949 12:118507932-118507954 CTAGTATTCTTTATCACTGTAGG - Intergenic
1104295552 12:127508831-127508853 CTAGTGTTCTATACCACTGTAGG + Intergenic
1105780886 13:23704566-23704588 CTAGTGTTCTACAGCACTGTAGG - Intergenic
1106220061 13:27739123-27739145 CTAGTGTTCTATAGCACTGTAGG + Intergenic
1106396406 13:29385164-29385186 CTAGTATTTCTCACAAATGTCGG - Intronic
1107285523 13:38786125-38786147 CTGGTTTTCTATACCACTGTAGG - Intronic
1107319668 13:39172354-39172376 CTAGTGTTCTATACCACTGTAGG - Intergenic
1107372038 13:39762440-39762462 CTAGTGTTCTATAGCACTGTAGG + Intronic
1107452596 13:40524023-40524045 CTAGTATTCTCTAACACTGTAGG + Intergenic
1107780317 13:43894355-43894377 CTAGTGTTCTATACCACTGTAGG - Intergenic
1108226017 13:48290105-48290127 CTAGTGTTCTATACCACCGTAGG - Intergenic
1108326863 13:49341655-49341677 CTAGTATTCAACAGCACAGTAGG + Intronic
1108606863 13:52048058-52048080 CTAGTGCTCTATACCACTGTAGG + Intronic
1109107605 13:58275527-58275549 CTAGTGTTCTATAGCACTGTAGG - Intergenic
1109194695 13:59365466-59365488 CTAGTGTTCTACACCATTATAGG - Intergenic
1109604284 13:64671884-64671906 CTAGTATTCTATACCACTGCAGG - Intergenic
1109915340 13:68977995-68978017 CTAGTGTTCTACATCATAGTAGG - Intergenic
1110118082 13:71845034-71845056 CTAGTGTTCTATAGCACTGTAGG + Intronic
1110692118 13:78442969-78442991 CTAGTATTAGACAGCAATGAGGG - Intergenic
1111848378 13:93540752-93540774 CTAGTGTTCTACACCACTGTAGG - Intronic
1112286542 13:98109554-98109576 CTAGTGTTCTATACCACTGTAGG - Intergenic
1112820016 13:103321976-103321998 CTAGTGTTCTATATCACTGTAGG + Intergenic
1116468649 14:45262113-45262135 CTAGTTTTCTATATCACTGTAGG - Intergenic
1116475416 14:45333637-45333659 CTAGTGTTCTATATCACTGTAGG - Intergenic
1116510416 14:45738480-45738502 CTAGTGTTCTATACCACTGTAGG - Intergenic
1117007408 14:51435719-51435741 CTAGTGTTCTATAGCACTGTGGG + Intergenic
1117902175 14:60546064-60546086 CTAGTGTTCTATACCACTATAGG - Intergenic
1118394732 14:65326333-65326355 CTAGTGTTCTAAAGCACTGTAGG + Intergenic
1119155168 14:72403522-72403544 CTAGTGTTCTATAGCACTGTTGG + Intronic
1120061537 14:79989206-79989228 CTGGTATTCTACACTTGTGTGGG - Intergenic
1120451029 14:84667112-84667134 CTAGTGTTCTATAGCACTGTAGG - Intergenic
1120756918 14:88253289-88253311 CTAGTGTTCTATACCACTGCAGG + Intronic
1120775473 14:88431526-88431548 CTAGTGTTCTATACCACTATAGG - Intronic
1121037380 14:90717736-90717758 TTAGTATTTTACACGAAGGTGGG - Intronic
1121628264 14:95403006-95403028 CTAGAATATTACACCACTGTAGG + Intergenic
1122586626 14:102812095-102812117 CTAGTGTTCTATAGCACTGTCGG - Intronic
1123188430 14:106543002-106543024 CTAGTGTTCTACAGCACAGTAGG - Intergenic
1202931398 14_KI270725v1_random:38641-38663 CTAGTTCTCTACAGCACTGTTGG + Intergenic
1123421034 15:20133470-20133492 CTAGTTCTCTACAGCACTGTTGG - Intergenic
1123530258 15:21139999-21140021 CTAGTTCTCTACAGCACTGTTGG - Intergenic
1124054866 15:26233025-26233047 CTAGTGTTCTATAGCACTGTAGG - Intergenic
1124947273 15:34281121-34281143 CTAGTATTCTACACTATTGAAGG + Intronic
1125251052 15:37704834-37704856 CTAATGTTCTATACCACTGTAGG - Intergenic
1126659462 15:51018088-51018110 CTAGTGTTCTGCAGCACTGTAGG - Intergenic
1126676982 15:51168425-51168447 CTAGTGTTCTATGCCACTGTAGG - Intergenic
1127369837 15:58329490-58329512 CTGGTGTTCTACAGCACTGTAGG + Intronic
1129815098 15:78545250-78545272 CTAGTGTTCTATACTACTGTAGG - Intronic
1132529233 16:436926-436948 CTAGTGTTCTATATCACTGTAGG + Intronic
1133315254 16:4879084-4879106 CTAGTGTTCTATACCACTGTAGG + Intronic
1133839586 16:9395368-9395390 CTGGTATTCTACAGCACTGTGGG - Intergenic
1133901848 16:9983182-9983204 CTAGTATTCTATCACACTGTAGG - Intronic
1135742681 16:24989935-24989957 CTAGTATTCTATAGCACTGTAGG + Intronic
1136722095 16:32329694-32329716 CTAGTTCTCTACAGCACTGTTGG - Intergenic
1136840419 16:33535661-33535683 CTAGTTCTCTACAGCACTGTTGG - Intergenic
1137470677 16:48754299-48754321 CTAGTGTTCTACACCACTGTAGG + Intergenic
1138308154 16:55997757-55997779 CTAGTGTTCTATAGCACTGTAGG - Intergenic
1138840705 16:60501353-60501375 CCAGTATTCTATACCACTGTAGG - Intergenic
1139812450 16:69633756-69633778 CTAGTGTTCTATACCACTGTAGG + Intronic
1140003265 16:71047907-71047929 CTAGTGTTCTATAGCACTGTGGG - Intronic
1140145685 16:72305284-72305306 CTAGTGTTCTATACTACTGTAGG - Intergenic
1140582555 16:76248773-76248795 ATAGTGTTCTATACCACTGTAGG + Intergenic
1203004336 16_KI270728v1_random:188080-188102 CTAGTTCTCTACAGCACTGTTGG + Intergenic
1203135946 16_KI270728v1_random:1724498-1724520 CTAGTTCTCTACAGCACTGTTGG + Intergenic
1203150585 16_KI270728v1_random:1835954-1835976 CTAGTTCTCTACAGCACTGTTGG - Intergenic
1144813035 17:18013715-18013737 CTAGTGTTCTATACCACTATGGG + Intronic
1149146059 17:53494218-53494240 CTAGTGTTCTATAACACTGTAGG + Intergenic
1149628535 17:58098794-58098816 CTAGTGTTCAATACCACTGTAGG - Intergenic
1151205053 17:72500525-72500547 CTAGTGTTCTATACCACTGTAGG + Intergenic
1151862863 17:76778673-76778695 CTAGTATTCTAAATCAAGGCAGG - Intronic
1153113946 18:1631605-1631627 CTAGTATTCTATAAAACTGTAGG + Intergenic
1155109587 18:22700641-22700663 CTAGTGTTCTGTACCACTGTAGG - Intergenic
1155331607 18:24724375-24724397 CTAGTGTTCTATGCCAGTGTAGG + Intergenic
1155437982 18:25832953-25832975 CTAGCATTCTATAGCACTGTAGG + Intergenic
1155648714 18:28114127-28114149 CTAGTGTTCTATAGCACTGTAGG + Intronic
1156217376 18:35013584-35013606 CTAGTGTTCTATACCATTGTAGG - Intronic
1156751705 18:40465599-40465621 CTAGTGTTCTATACCACTGTAGG - Intergenic
1156785391 18:40906768-40906790 CTAGTGTTCTATAGCACTGTTGG + Intergenic
1157147646 18:45181001-45181023 CTGGTATGCTGCACCACTGTGGG + Intergenic
1157220009 18:45822466-45822488 CTAGTGTTCTATAGCACTGTAGG + Intergenic
1158270738 18:55712964-55712986 CTATTGTTCTACAGCACTGTAGG - Intergenic
1159075860 18:63681220-63681242 CTAGTGTTCTATAGCACTGTAGG + Intronic
1159463271 18:68747146-68747168 CTAGTGTTCTACAACACTGTAGG - Intronic
1162879215 19:13645526-13645548 CTAGTGTTCTATACCACTGTAGG + Intergenic
1163094194 19:15043981-15044003 CTAGTGTTCTACAGCACTGTAGG - Intergenic
1164486867 19:28665660-28665682 CTAGGGTTCTACAGCATTGTAGG + Intergenic
1165260228 19:34608368-34608390 CTAGTTTTCTATAGCACTGTAGG - Intronic
1166407399 19:42530651-42530673 CTAATGTTCTATACCACTGTAGG + Intronic
1166577974 19:43862364-43862386 CTAGTATTCTATACTACTGTGGG + Intergenic
1167727601 19:51226785-51226807 CTGGTGTTCTATACCACTGTAGG - Intronic
1167737396 19:51304038-51304060 CTAGTGTTCTATAGCACTGTAGG + Intergenic
1168184761 19:54692653-54692675 CTGGTATCCTACAGCACTGTAGG + Intronic
1168184793 19:54693031-54693053 CTGGTATCCTACAGCACTGTAGG + Intronic
1168184805 19:54693184-54693206 CTGGTATCCTACAGCACTGTAGG + Intronic
1168184811 19:54693259-54693281 CTGGTATCCTACAGCACTGTAGG + Intronic
1202690664 1_KI270712v1_random:87598-87620 CTAGTTCTCTACAGCACTGTTGG - Intergenic
925031287 2:651790-651812 CTATTGTTCCACACCACTGTAGG - Intergenic
926570820 2:14528024-14528046 CTGAGATTCAACACCAATGTAGG + Intergenic
926618002 2:15018214-15018236 CTAGTGTTTTACACCACTGTAGG + Intergenic
927305217 2:21563464-21563486 CTAGTGTTCTATAGCACTGTGGG + Intergenic
927619523 2:24638029-24638051 CTAGTGTTCTATACCACTGTTGG - Intronic
927620849 2:24656535-24656557 CTAGTGTTCTATAGCATTGTAGG - Intronic
927836002 2:26399881-26399903 CTAGTGTTCTGCACCACTGGAGG - Intergenic
928783393 2:34852426-34852448 CTAGTTTTCTACAGCACTATAGG - Intergenic
930254524 2:49075112-49075134 CTAGTGTTCTATATCACTGTAGG + Intronic
930500078 2:52203520-52203542 CTAGTGTTCTATAGCACTGTAGG + Intergenic
930964393 2:57303632-57303654 TTAGTGTTCTATACCATTGTAGG + Intergenic
932629630 2:73328313-73328335 CTAGTGTTCTATAGCACTGTGGG - Intergenic
932905438 2:75745001-75745023 CTAGTGTTCTCTACCACTGTAGG + Intergenic
933467347 2:82670505-82670527 ATAGTATTCTATACCACTGTAGG + Intergenic
933570911 2:84010718-84010740 CTAGTGTTCTATAGCATTGTAGG + Intergenic
933594465 2:84268771-84268793 CTAGTGTTCTATACCACTGTAGG + Intergenic
933819543 2:86097814-86097836 CTAGTGTTCTACACCATTATAGG + Intronic
933955747 2:87368406-87368428 CTAGTTCTCTACAGCACTGTTGG + Intergenic
934239900 2:90260439-90260461 CTAGTTCTCTACAGCACTGTTGG + Intergenic
934323993 2:91993134-91993156 CTAGTTCTCTACAGCACTGTTGG + Intergenic
934462347 2:94223705-94223727 CTAGTTCTCTACAGCACTGTTGG + Intergenic
935351685 2:102156265-102156287 CTAGTATTCTAGACTATTTTGGG + Intronic
936441427 2:112557267-112557289 CTGGTATTCTGCAGCAATGTAGG - Intronic
936850658 2:116894314-116894336 CTAGTGTTCTATAGCATTGTAGG - Intergenic
937527136 2:122785145-122785167 CGAGTGTTCTACACCACAGTAGG + Intergenic
937701157 2:124864424-124864446 CTAGTGTTCTATAGCACTGTAGG - Intronic
938575817 2:132603444-132603466 CTAGTGTTCTATAGCAGTGTAGG + Intronic
939317663 2:140573067-140573089 CTAGTGTTCTATAGCACTGTAGG + Intronic
939735143 2:145834876-145834898 CTAGTGTTCTATAACATTGTAGG - Intergenic
940091975 2:149930761-149930783 CTAGTGTTCCATACCACTGTAGG + Intergenic
940580926 2:155579018-155579040 CTAGTATTCTACAGCACTGTAGG + Intergenic
940730330 2:157382101-157382123 TTAGTGTTCTATACCACTGTAGG + Intergenic
941037270 2:160582083-160582105 CCAGTGTTCTATACCACTGTAGG - Intergenic
941482648 2:166036553-166036575 TTATAATTTTACACCAATGTAGG + Intronic
941806218 2:169714015-169714037 ATGGTAATCTACACCAATGCTGG - Intronic
942816039 2:180055278-180055300 CTGGTGTTCTATACCACTGTAGG + Intergenic
943175662 2:184470150-184470172 CTAGTATTCTATAGCACAGTAGG + Intergenic
943398024 2:187366282-187366304 CTAGTGTTCTATATCACTGTAGG + Intronic
943829901 2:192447356-192447378 CTAATGTTCTATACCACTGTGGG - Intergenic
944108032 2:196100568-196100590 CTAGTGTTCTATACCACTGTAGG + Intergenic
944695330 2:202195593-202195615 CTAGTGTTCTATAGCACTGTAGG - Intronic
945078776 2:206067384-206067406 CTAGTGTTCTATAGCACTGTAGG + Intronic
945110168 2:206355409-206355431 CTAGTAGTCTATAACACTGTAGG - Intergenic
945329850 2:208526321-208526343 CTAGTGTTCCACAGCACTGTAGG - Intronic
945598186 2:211822221-211822243 CTACTGTTCTACAGCACTGTAGG + Intronic
946722780 2:222628219-222628241 CTATTGTTCTACAGCACTGTAGG + Intronic
946917339 2:224538259-224538281 CTAATTTTCTACAGAAATGTTGG - Intronic
946971272 2:225094516-225094538 CTAGTGTTCTATACCACTGTAGG - Intergenic
948341874 2:237259564-237259586 CTAGTGGTCTATACCACTGTAGG + Intergenic
948344930 2:237287575-237287597 CCAGGATTCTATAGCAATGTTGG + Intergenic
948759688 2:240182979-240183001 CTAGTTTTCTTCTCCAATCTGGG + Intergenic
1169665868 20:8034810-8034832 CTAGTGTTCTACAGCACTGTAGG + Intergenic
1169682290 20:8228957-8228979 CTAGTGTTCGACAGCAATGTAGG - Intronic
1170146308 20:13178849-13178871 CTAGTGTTCTATACCACTGTAGG + Intergenic
1172562008 20:35897511-35897533 CTAGCATTCTACAGCACTATGGG - Intronic
1172563905 20:35913226-35913248 CTAGAATTAAACACAAATGTTGG - Intronic
1172807124 20:37620232-37620254 CTAGTGTTCTATACCAGTGTAGG - Intergenic
1173767241 20:45623836-45623858 CTAGTGTTCTATAGCACTGTAGG - Intronic
1175020201 20:55838877-55838899 CTAGTATTCTATAGCACAGTAGG - Intergenic
1176593427 21:8666794-8666816 CTAGTTCTCTACAGCACTGTTGG + Intergenic
1177209877 21:18058041-18058063 CTAGTGTTCTACAGAACTGTAGG - Intronic
1177760207 21:25394532-25394554 CTAGTGCTCTACACTACTGTAGG + Intergenic
1177821695 21:26037291-26037313 CTAGTGCTCTACAGCACTGTAGG + Intronic
1177960815 21:27663821-27663843 CTAGTTTTCTATAGCACTGTAGG + Intergenic
1178464126 21:32831379-32831401 CCAGTGTTCTATACCATTGTAGG - Intergenic
1178782574 21:35618609-35618631 CTAGTGTTCTATACCCCTGTAGG + Intronic
1179240512 21:39586497-39586519 CTAGTTTTCTGCAGCACTGTAGG + Intronic
1179406042 21:41126727-41126749 CTAGTATTCTACAGGACTGTAGG - Intergenic
1180276274 22:10643922-10643944 CTAGTTCTCTACAGCACTGTTGG + Intergenic
1180550751 22:16536935-16536957 CTAGTTCTCTACAGCACTGTTGG + Intergenic
1180978397 22:19864772-19864794 CTAGTGTTCTACACCACTGTAGG + Intergenic
1181063709 22:20295111-20295133 CTAGTGTTCTACACCAATGTAGG - Intergenic
1181353881 22:22283026-22283048 CTAGTTCTCTACAGCACTGTTGG - Intergenic
1181861276 22:25820740-25820762 CTAGTGTTCTATAGCATTGTAGG - Intronic
1181922569 22:26332061-26332083 CTAGTGTTCTATAACACTGTAGG + Intronic
1182496741 22:30713976-30713998 CTAGTGTTCTACAGCACTGTAGG - Intronic
1184075809 22:42176920-42176942 CTAGTATTCTGTATCACTGTAGG + Intronic
949144498 3:680967-680989 CTAGTGTTCTATACCACTGTAGG - Intergenic
950835655 3:15916566-15916588 CTAGTGTTCTATAGCATTGTAGG + Intergenic
951152479 3:19307968-19307990 CTAGTGTTCTGTACCACTGTAGG + Intronic
951480484 3:23156359-23156381 CTAGTACTCTATACCACTGTAGG + Intergenic
951638530 3:24807502-24807524 CTAGTGTTCTAGACCACTGGAGG + Intergenic
952311655 3:32195982-32196004 CTAATGTTCTATACCAGTGTAGG - Intergenic
952429780 3:33212022-33212044 CTAGTGTTCTATACCACTGTAGG + Intronic
952456844 3:33480636-33480658 CTAGTGTTCTATACCACTCTAGG + Intergenic
953131047 3:40138887-40138909 CTAGTGTTCTATACCACAGTAGG - Intronic
953265846 3:41387307-41387329 CTAGCATTCTATACCGTTGTAGG - Intronic
955257253 3:57344845-57344867 CTAGTATTCAATAGCACTGTAGG + Intronic
956042051 3:65155063-65155085 CTAGTGTTCTATAGCACTGTAGG - Intergenic
958686165 3:97399018-97399040 CTAGTGTTCTACAGCACTGTAGG - Intronic
959092221 3:101915867-101915889 CTAGTGTTCTATACCACTGTAGG - Intergenic
959955176 3:112229249-112229271 CTAGTGTTCTACAGCACTGCAGG + Intronic
960315809 3:116175452-116175474 ATAGTGTTCTATACCATTGTAGG - Intronic
962426689 3:135275177-135275199 CTAGTGTTCTATAGCACTGTAGG - Intergenic
963258660 3:143171533-143171555 TTAGTATTCTGCAGTAATGTGGG + Intergenic
963371677 3:144409029-144409051 ATAGTGTTCTACACCACAGTAGG - Intergenic
963470264 3:145731723-145731745 CTAGTATCCTAGACCAAGCTTGG + Intergenic
963535863 3:146527255-146527277 CTAGTGTTCTATAGCTATGTAGG + Intronic
963573083 3:147022283-147022305 CTAGTGTTCTATATCACTGTCGG - Intergenic
963573196 3:147023785-147023807 CTTGTGTTCTATACCACTGTTGG + Intergenic
963935256 3:151045729-151045751 CTAGTGTTCTATACCACTGTAGG + Intergenic
964274418 3:154993975-154993997 CTAGTGTTCTATAGCACTGTAGG + Intergenic
965038956 3:163481423-163481445 ATAGTATTATACACCAAAGAAGG - Intergenic
965246918 3:166284477-166284499 CTAGTGTTCTACAGCACTGTAGG - Intergenic
965377892 3:167949081-167949103 CTAGTATTCTATAGCAATGTAGG + Intergenic
965381444 3:167994262-167994284 CTACTATTATAGACCAAAGTTGG - Intergenic
966543028 3:181113302-181113324 CTAGTGCTCTATACCACTGTAGG - Intergenic
966972633 3:185059597-185059619 CTAGTGTTCAGCACCACTGTAGG + Intergenic
967150453 3:186644184-186644206 CTAGTGTTCTGGACCACTGTAGG - Intronic
970042634 4:11813017-11813039 TTAGCATTCTAAACCAAAGTAGG + Intergenic
970175904 4:13339279-13339301 CTAGTGTTCCATACCACTGTAGG - Intergenic
971034395 4:22677384-22677406 CTAGTATTCTATAGAACTGTAGG - Intergenic
971386106 4:26141716-26141738 CTAGTATTCTATAGCTCTGTAGG - Intergenic
971811160 4:31429274-31429296 CTAGTGTTCTATACCACTATAGG - Intergenic
972158053 4:36189475-36189497 CTAGTGTTCTATAGCACTGTAGG - Intronic
973304381 4:48628596-48628618 CTAGTGTTCTATACCACTGCAGG + Intronic
973308510 4:48679611-48679633 CTAGTGTTCTATACCACTGTAGG + Intronic
973952734 4:56034130-56034152 CTAGTATTCTCTACCACTGCAGG - Intergenic
974615728 4:64278677-64278699 CTGGTGTTCTATACCACTGTAGG - Exonic
974737545 4:65957281-65957303 CTAGTGTTCTATAGCAGTGTAGG - Intergenic
975235839 4:71995892-71995914 CTTCTATTCTATACCATTGTAGG + Intergenic
975409627 4:74034908-74034930 CTAGTGTTTTATACCACTGTAGG - Intergenic
975700308 4:77059686-77059708 CTAGTGTTCCATACCATTGTAGG - Intronic
976496101 4:85731669-85731691 CTAGTGTTCTATACTACTGTAGG + Intronic
976657267 4:87502337-87502359 CTAGTGCTCTATACCACTGTAGG - Intronic
976672379 4:87667803-87667825 CTAGTGTTCTATAGCACTGTAGG - Intergenic
977180212 4:93865057-93865079 CTAGTTTTCTATACTACTGTAGG + Intergenic
978879071 4:113678685-113678707 CTAGTCTTCTACAACACTGTAGG - Intronic
979942454 4:126779000-126779022 CTAGTATTCTAAACACATTTTGG - Intergenic
980563348 4:134505273-134505295 CAAGTATTCTCCACCAAAGAGGG - Intergenic
980664814 4:135917652-135917674 CTAGTGTTCTATACCACCGTAGG + Intergenic
980819084 4:137989469-137989491 CTAGTGTTCTATACCACTGTAGG + Intergenic
981088231 4:140705640-140705662 CTAGTATTCTACATCAATAGAGG - Intronic
981771041 4:148308657-148308679 CTAGTGTTCTATAGCACTGTGGG + Intronic
982016384 4:151158012-151158034 CTAGTGTTCTATACCACTGCAGG + Intronic
982425864 4:155259092-155259114 CTAGTGTTCTACAGCACAGTAGG - Intergenic
983155687 4:164345060-164345082 CTAGTGCTCTATACCATTGTAGG + Intronic
983396726 4:167206906-167206928 CTAGTGTTCTATAGCACTGTAGG + Intronic
984199749 4:176703550-176703572 CTAGTATTCCACAGCACAGTAGG + Intronic
985480002 5:103783-103805 CTAGTAGTCTACAACACAGTAGG - Intergenic
986883951 5:12211292-12211314 CCAGTGTTCTATACCACTGTTGG + Intergenic
986891054 5:12306113-12306135 CTAGTGTTCTATAGCATTGTAGG + Intergenic
987109297 5:14669985-14670007 CTAGTGTTCTATACCATTGTAGG - Intronic
987161371 5:15147308-15147330 CTAGTCTTCTATAGCACTGTAGG + Intergenic
987650076 5:20729769-20729791 CTAGTGTTCTATAGCATTGTGGG - Intergenic
988345142 5:30027719-30027741 CTAGTGTTCTATACCACTGTTGG - Intergenic
988745483 5:34131698-34131720 CTAGTGTTCTATAGCATTGTGGG + Intergenic
989297274 5:39844273-39844295 CTAGTGTTCTATAGCACTGTAGG - Intergenic
990733643 5:58836449-58836471 CTAGTGTTCTGTACCACTGTAGG - Intronic
991042111 5:62186901-62186923 CTAGTGTTCTACAGCACTGTAGG + Intergenic
991408145 5:66321553-66321575 CTAGTGTTCTATACCACTGTAGG + Intergenic
991451947 5:66760750-66760772 CTAGTGTTCTATACTACTGTAGG + Intronic
992024656 5:72658355-72658377 CTAATATTCTACCCAGATGTAGG - Intergenic
992406742 5:76465685-76465707 CTAGTATCCTACAACCATGATGG - Intronic
993122001 5:83786541-83786563 CTAGTGTTCTATAGCACTGTAGG - Intergenic
993122006 5:83786709-83786731 CTAGTGTTCTATAGCACTGTAGG - Intergenic
993195942 5:84745945-84745967 CTATTATACTATACCAATGAAGG + Intergenic
994357390 5:98809263-98809285 CTAGTGTTCTATACCACTGGAGG + Intergenic
994832840 5:104808860-104808882 CTAGTGTTCTATACCACTGTAGG + Intergenic
995001893 5:107142975-107142997 TTAGTGTTTTACACCATTGTAGG + Intergenic
995213142 5:109563741-109563763 CTAGTGTTCTATAGCACTGTAGG - Intergenic
995782857 5:115796381-115796403 CTAGAGTTCTACAACACTGTAGG + Intergenic
995849401 5:116529315-116529337 CTAGTGTTCTATAGCACTGTAGG + Intronic
995943179 5:117609654-117609676 CTAGTGTTCTATACCACTGTAGG - Intergenic
995969897 5:117955567-117955589 CTAGTATTCTATACCACTGTAGG - Intergenic
996444920 5:123536482-123536504 CTAGTTTTCCATACCACTGTAGG + Intronic
996878137 5:128262685-128262707 CTATTATCATACACCATTGTTGG + Intronic
996999557 5:129743225-129743247 CTAGTGTTCTATATCACTGTAGG + Intergenic
997122726 5:131192346-131192368 CTAGTGTTCTATAGCACTGTAGG + Intronic
997219325 5:132146992-132147014 CTAGTGTTCTATAGCACTGTAGG + Intergenic
997487191 5:134241178-134241200 CCAGGATTCTACCCCAATATGGG - Intergenic
998198733 5:140100071-140100093 CTAGTGTCCTACAGCACTGTAGG - Intergenic
998777790 5:145621762-145621784 CTAGTATTCTATGGCACTGTTGG + Intronic
999706789 5:154280329-154280351 CTAGTGTTCTATAGCACTGTAGG + Intronic
1000811473 5:165867561-165867583 CTAGTTTTCTATAACACTGTAGG + Intergenic
1000835482 5:166148181-166148203 CTAGTGTTCTATAGCACTGTAGG + Intergenic
1002867373 6:1133972-1133994 CTAGTGTTCTGCAGCACTGTAGG - Intergenic
1003118380 6:3298605-3298627 CTAATGTTCTACGCCACTGTAGG + Intronic
1003247118 6:4392138-4392160 CTAGTGTTCTACAGCACTGTAGG - Intergenic
1004246439 6:13981960-13981982 CTAGTATTCCATAACACTGTAGG - Intergenic
1004438289 6:15619143-15619165 CTAGTATTCTATAGCACTGTAGG + Intronic
1004723205 6:18287061-18287083 CTAGTGTTCTATACCACTGTAGG - Intergenic
1004951249 6:20674653-20674675 CTAGTGTTCTACAGCACAGTAGG - Intronic
1005383554 6:25262765-25262787 CTATTGTTCTATACCACTGTAGG + Intergenic
1005543599 6:26839447-26839469 CTAGTGTTCTATAGCATTGTGGG + Intergenic
1006267786 6:32939545-32939567 CTAGTGTTCTATACCACTGTGGG + Intronic
1006936554 6:37722858-37722880 CTAGTACTCCACATCCATGTCGG + Intergenic
1008308767 6:49938690-49938712 TTAGTGTTCTACACCACTGTAGG - Intergenic
1009014426 6:57881620-57881642 CTAGTGTTCTATAGCATTGTGGG + Intergenic
1009030435 6:58050890-58050912 CTAGTGTTCTATAGCACTGTAGG - Intergenic
1009205966 6:60802058-60802080 CTAGTGTTCTATAGCACTGTAGG - Intergenic
1009352146 6:62694357-62694379 CTAGTGTTCTATACCACTATAGG + Intergenic
1009462541 6:63931842-63931864 CTAGCATTCTATAACACTGTAGG - Intronic
1011279297 6:85661168-85661190 CTAGTGTTCTACACCACTGTGGG - Intergenic
1011951745 6:92975402-92975424 CTACTATTCTACAGCACTGTAGG + Intergenic
1013326483 6:109049456-109049478 CTAGTGTTCCATAGCAATGTAGG + Intronic
1013420621 6:109963282-109963304 CTAGCGTTCTATACCACTGTGGG + Intergenic
1013670323 6:112395107-112395129 CTACTGTTCTATACCACTGTAGG - Intergenic
1016384604 6:143518066-143518088 GGTGTATTCTACAACAATGTTGG + Intergenic
1016414413 6:143817915-143817937 CTAGTGTTCTATAGCACTGTAGG + Intronic
1016506257 6:144783645-144783667 CTAGTGTTCTATAGCACTGTAGG - Intronic
1018074359 6:160197955-160197977 CTAGTATTCTATACCACTATAGG + Intronic
1018126467 6:160687485-160687507 CTAGTGTTCTATACCACTGCAGG + Intergenic
1018134929 6:160769845-160769867 CTAGTGTTCTATACCACTGTAGG + Intergenic
1018841454 6:167520224-167520246 CTAGTGTTTTACAGCACTGTAGG - Intergenic
1021127790 7:16873519-16873541 GTAGTATTCTACAGCACTATAGG + Intronic
1021680023 7:23120891-23120913 CTAATATTCTATATCACTGTAGG - Intronic
1023137470 7:37066561-37066583 CTAGTGTTCTATACCACCGTAGG + Intronic
1024349061 7:48344511-48344533 ATAAAATTCTACACTAATGTGGG - Intronic
1024522729 7:50320498-50320520 CTAGTGTTCTACACCATTGCAGG - Intronic
1027401790 7:77816637-77816659 CTAGTGTTCTATACCACTGTTGG - Intronic
1028004673 7:85549521-85549543 CTAGTGTTCCATACCACTGTAGG - Intergenic
1028010130 7:85632242-85632264 CTATTTTTCTATACCACTGTAGG - Intergenic
1028449779 7:90968445-90968467 CTATTTTCCTACACCCATGTGGG + Intronic
1028450379 7:90975606-90975628 CTAGTGTCTTATACCAATGTAGG - Intronic
1028791066 7:94853522-94853544 CTAGTGTTCTATAACACTGTAGG - Intergenic
1028802825 7:94986537-94986559 CCAGTGTTGTACAGCAATGTAGG + Intronic
1028819631 7:95191532-95191554 CTAGTGTTCTATACCGTTGTGGG - Intronic
1028975785 7:96912430-96912452 TTACCATTCTACACAAATGTTGG + Intergenic
1029168288 7:98612307-98612329 CTGGTGTTCTACAGCACTGTAGG - Intergenic
1030020585 7:105271551-105271573 CTGGAATTCTTCACGAATGTGGG - Intronic
1030647093 7:112073832-112073854 CTAGTATTCTGTAGCACTGTAGG + Intronic
1030775757 7:113532212-113532234 CTAGTGTTCTAAACCACTATAGG - Intergenic
1031071102 7:117162840-117162862 CTAGTGTTCCATACCAGTGTAGG - Intronic
1031265949 7:119580465-119580487 CTAGTATTCTATACCACTGAAGG + Intergenic
1031328986 7:120439575-120439597 CCAGTGTTCTACAGCACTGTAGG - Intronic
1031802338 7:126263783-126263805 TTGGTATTCTACAGCACTGTAGG + Intergenic
1032992450 7:137409030-137409052 CTAGTGTTCCATACCATTGTAGG + Intronic
1033005870 7:137561492-137561514 TTAGTGTTCTATACCACTGTAGG + Intronic
1033272684 7:139946914-139946936 CAAGTATTCTCCAACAAGGTCGG + Intronic
1033942007 7:146666061-146666083 CTAGTGTTCTATACCACTTTAGG - Intronic
1034687235 7:152983432-152983454 CTAGTGTTCTATACCACTGTAGG + Intergenic
1034739517 7:153460958-153460980 CTAGTGTTCTACATTACTGTAGG + Intergenic
1036502538 8:9326845-9326867 CTAGTGTTCTATAGCACTGTAGG - Intergenic
1036675773 8:10831359-10831381 CTAGTGTTCTATAGCACTGTAGG + Intronic
1037110040 8:15154896-15154918 CTAGTGTTCTACAGCAGTGTAGG + Intronic
1037127714 8:15370922-15370944 CTAGTGTTCTATACCATTATAGG + Intergenic
1038237799 8:25777803-25777825 CTAGTGTTCTGCAGCACTGTAGG - Intergenic
1038308176 8:26423259-26423281 CTAGTGTTCTATAGCACTGTGGG - Intronic
1039005672 8:33034206-33034228 CTAGTGTTCTACAGCACTGTGGG + Intergenic
1041283939 8:56241010-56241032 CTAGTGTTCTGTACCACTGTAGG + Intergenic
1041283970 8:56241381-56241403 CTAGTGTTCTGTACCACTGTAGG + Intergenic
1042234139 8:66590840-66590862 CTAGTGTTCTATATCACTGTAGG + Intronic
1043687670 8:83107626-83107648 CTGGTGTTCTACAGCACTGTAGG + Intergenic
1043709269 8:83394478-83394500 CTAGTGTTCTATACCATTGTAGG + Intergenic
1043917644 8:85941295-85941317 CTAGTGTTCTATAGCACTGTAGG - Intergenic
1044350197 8:91155550-91155572 CTAGTATTCTATAGCACTGTAGG - Intronic
1045222813 8:100215082-100215104 CTAGTGTTCTATAGCACTGTAGG - Intronic
1045595867 8:103655752-103655774 CTACTATACTACACCCATCTTGG - Intronic
1046185925 8:110717813-110717835 CTAGTGTTGTATACCACTGTAGG + Intergenic
1046452016 8:114405852-114405874 CTAGTGTTCTACAGCATTATAGG + Intergenic
1046788989 8:118300227-118300249 CTAGTGTTCTATAGCACTGTGGG - Intronic
1047594744 8:126366828-126366850 CTAGTGTTCTATATCACTGTAGG + Intergenic
1050315755 9:4399085-4399107 CTAGTGTTCTATACCATTGCAGG + Intergenic
1050572133 9:6951239-6951261 CTAGTGTTCCATACCACTGTAGG - Intronic
1051803037 9:20958600-20958622 CTAGTGTTCTATACTACTGTAGG - Intronic
1051828522 9:21249344-21249366 CTAGTTTTATATACCATTGTAGG + Intergenic
1051966969 9:22840453-22840475 CTAGTATTCAACAGCACAGTAGG + Intergenic
1052715436 9:32110554-32110576 CTAATATTCTCGACCACTGTTGG - Intergenic
1053146538 9:35715853-35715875 CTAGCGTTCTACACCACTGTAGG + Intronic
1053692861 9:40604356-40604378 CTAGTTCTCTACAGCACTGTTGG + Intergenic
1054271972 9:63035738-63035760 CTAGTTCTCTACAGCACTGTTGG - Intergenic
1054304102 9:63403583-63403605 CTAGTTCTCTACAGCACTGTTGG + Intergenic
1054402848 9:64727596-64727618 CTAGTTCTCTACAGCACTGTTGG + Intergenic
1054436471 9:65213086-65213108 CTAGTTCTCTACAGCACTGTTGG + Intergenic
1054493927 9:65808908-65808930 CTAGTTCTCTACAGCACTGTTGG - Intergenic
1054826302 9:69577190-69577212 CTAGTCTTCTATACCATTGTAGG - Intronic
1055345630 9:75334440-75334462 CTAGTGTTCTTTACCACTGTAGG + Intergenic
1055706025 9:79005169-79005191 CTAGTGTTCTATACCACTATAGG - Intergenic
1056288538 9:85116334-85116356 CTAGTGTTCTATAGCACTGTAGG + Intergenic
1056947985 9:91017027-91017049 CTAGGGTTCTACAGCACTGTGGG + Intergenic
1057120420 9:92567530-92567552 CTAGTGTTCTATACTACTGTAGG - Intronic
1057329112 9:94095589-94095611 CTAGTGTTCTGTACCACTGTAGG + Intronic
1057876579 9:98759904-98759926 CTAGTGCTCTATACCACTGTAGG + Intronic
1058584886 9:106496376-106496398 CTAGTGTGCTATACCACTGTTGG + Intergenic
1058652299 9:107188010-107188032 CTAGTGTTCTATAGCACTGTAGG + Intergenic
1060319774 9:122547018-122547040 CTAGTGTTCTATACCACTGTAGG - Intergenic
1203623561 Un_KI270749v1:147020-147042 CTAGTTCTCTACAGCACTGTTGG + Intergenic
1185888617 X:3804496-3804518 CTAGTGTTCTATAGCACTGTAGG + Intergenic
1186069240 X:5800154-5800176 CTAGTGTTCTACAGCACAGTAGG + Intergenic
1187770818 X:22693749-22693771 CTAGTGTTTTATACCACTGTAGG - Intergenic
1187916811 X:24160781-24160803 CTAGTGTTCTATAGCACTGTAGG - Intronic
1187949860 X:24461210-24461232 CTAGTGTTCTATAGCACTGTAGG - Intergenic
1188167076 X:26874628-26874650 CCAGTGTTCTATACCACTGTAGG + Intergenic
1188877659 X:35450879-35450901 CTAGTTTTCTACAACATTGTAGG - Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1190156742 X:47999630-47999652 CTAGCATTCAACAACACTGTAGG + Intronic
1190622474 X:52301125-52301147 CTAGTGTCCTATACCACTGTAGG - Intergenic
1191904008 X:66068323-66068345 CTAGTGTTCTATACCACTGTAGG - Intergenic
1191961644 X:66709592-66709614 CTAGTTCTCTATACCATTGTAGG - Intergenic
1191963961 X:66735734-66735756 CTAGTGTTCTATAGCACTGTAGG - Intergenic
1192291702 X:69803727-69803749 CTAGTATTCTACACCAATGTAGG - Intronic
1192637709 X:72835313-72835335 CTAGTGTTCTATAGCACTGTAGG + Intronic
1192644005 X:72885502-72885524 CTAGTGTTCTATAGCACTGTAGG - Intronic
1193320960 X:80120636-80120658 TTAGTACTCTTAACCAATGTAGG + Intergenic
1193345010 X:80395763-80395785 CTAGTTTTCTACGCCACTGTAGG - Intronic
1193674302 X:84430088-84430110 CTAGTGTTCTATACCACTGTAGG - Intronic
1193883440 X:86955633-86955655 CTAGTGTTCTAGAGCACTGTAGG - Intergenic
1194203228 X:90979877-90979899 GTAGTGTTCTATACCAATGTAGG - Intergenic
1194279220 X:91926877-91926899 CTAGTATTCTATAGCATTGTAGG - Intronic
1194328376 X:92550013-92550035 CTAGCATTCTATAGCACTGTAGG - Intronic
1194855953 X:98928844-98928866 CTAGTGTTCTATAGCACTGTAGG + Intergenic
1195153241 X:102096057-102096079 CTGGTGTTCTGCAGCAATGTAGG + Intergenic
1195196845 X:102505823-102505845 CTAGCATTCTATACCACTGTAGG - Intergenic
1195203264 X:102570052-102570074 CTAGTGTTTTACAGCATTGTGGG + Intergenic
1195745208 X:108110515-108110537 CTAGTGTTCTATACCATTGTAGG - Intronic
1195747694 X:108135337-108135359 TTAATATTCTACACCAAAGGAGG - Intronic
1197258268 X:124287924-124287946 CTAGTAGTCTATACCATTGTAGG - Intronic
1197841639 X:130753972-130753994 CTGGTGTTCTTCAGCAATGTAGG + Intronic
1200031628 X:153301604-153301626 CTAGTGTTCTATAGCACTGTAGG + Intergenic
1200549059 Y:4555303-4555325 GCAGTGTTCTATACCAATGTAGG - Intergenic
1200596695 Y:5150372-5150394 CTAGTATTCTATAGCATTGTAGG - Intronic
1200637083 Y:5669236-5669258 CTAGCATTCTATAGCACTGTAGG - Intronic
1200773468 Y:7148711-7148733 CTAGTGTTCTATAGCACTGTAGG - Intergenic