ID: 1192292509

View in Genome Browser
Species Human (GRCh38)
Location X:69812641-69812663
Sequence TTGTCATGATAGAAGTCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192292509 Original CRISPR TTGTCATGATAGAAGTCTGC AGG Intronic
902301040 1:15502946-15502968 TTGTCCTGAGGGAACTCTGCTGG + Intronic
904258108 1:29269977-29269999 TTATCATTATAGAAGTCTGGAGG - Intronic
905032226 1:34893353-34893375 TTCTCATAATATAAGTCTCCTGG - Intronic
908067427 1:60422191-60422213 TTGTCATGATTTTATTCTGCTGG - Intergenic
908414664 1:63901264-63901286 TTGTCAGGATAGAGCTCTGCTGG - Intronic
909299086 1:73988382-73988404 TTGAAATGACAGAAGGCTGCAGG + Intergenic
910444836 1:87289579-87289601 TTGTGATGATGGAAGTGTTCTGG - Intergenic
919214614 1:194535715-194535737 ATGTCATTATAGAAGTCTGGTGG - Intergenic
921230944 1:213069966-213069988 TTGTCATCAGGGAAGTCTGAAGG + Intronic
1063470651 10:6282129-6282151 TTTTCATGATAAAATTCAGCCGG - Intergenic
1064249490 10:13695952-13695974 TTAACACGATGGAAGTCTGCGGG + Intronic
1064435411 10:15306872-15306894 TAGTCATGATGGATGTCAGCTGG - Intronic
1068228828 10:54143127-54143149 TTGTTATGTTAGAATTATGCAGG + Intronic
1070045432 10:72829961-72829983 GTGTCATTATAGAAGTAGGCGGG + Intronic
1070317254 10:75326391-75326413 TTTTCTTGATATAAGTGTGCTGG + Intergenic
1071391660 10:85181388-85181410 TTGTTGTGATAGAAGTCTGAGGG + Intergenic
1072302567 10:94075663-94075685 ATGTCATGAGACAAGTATGCTGG + Intronic
1074659601 10:115638109-115638131 TTATCATGAATGAAGTTTGCAGG - Intronic
1075488355 10:122846177-122846199 TTGACATCATTGAAGTCTTCAGG + Exonic
1079705609 11:23613720-23613742 ATGTCATGATAGATGTTTGCTGG - Intergenic
1082229730 11:49748468-49748490 TTGTCATGATATAAGTCAAATGG + Intergenic
1084072585 11:66745662-66745684 TTGTCATCAAAGAAGGCGGCGGG + Intronic
1084507723 11:69579404-69579426 TTCTCATAAAAGAAGTCTGGAGG - Intergenic
1085314060 11:75532857-75532879 ATGTCTTGATAGAAGACAGCTGG + Intergenic
1086620349 11:88880655-88880677 TTGTCATGATATAAGTCAAATGG - Intronic
1087795137 11:102448476-102448498 ATGTCAGCACAGAAGTCTGCAGG - Intronic
1095711610 12:45294838-45294860 TTGTCAAGATAGAAGTCAGAAGG + Intronic
1098319843 12:69232225-69232247 ATGTCCAGATAGAAGTCTGCTGG + Intergenic
1099260429 12:80374043-80374065 TTGTTATGATATTAGTTTGCAGG + Intronic
1101199393 12:102418839-102418861 TTGTAATGATCAAAATCTGCAGG - Intronic
1101464247 12:104931364-104931386 TTGTCATTATTGTGGTCTGCAGG - Intronic
1102614753 12:114143849-114143871 TTGTCATTAGAAAACTCTGCAGG + Intergenic
1103036636 12:117662259-117662281 GTGTCTTGACAGAAGTTTGCTGG - Intronic
1103232335 12:119342074-119342096 TTCTCATGTGAGAAGTCTGGAGG + Intronic
1106945813 13:34826504-34826526 TTATAAAGACAGAAGTCTGCTGG + Intergenic
1108384658 13:49887890-49887912 TTGTTATGTTAGAATTATGCAGG + Intergenic
1109126577 13:58525906-58525928 TTGTTATGTTAGAATTATGCAGG + Intergenic
1112002527 13:95224427-95224449 TTCTTATAGTAGAAGTCTGCTGG - Intronic
1112229462 13:97573413-97573435 TTTTCAAGATAGAAGTCCCCAGG - Intergenic
1114319782 14:21537739-21537761 TTTTCATGATAGCAGTTTGGTGG - Intergenic
1116555699 14:46303412-46303434 TTCTCATGGTACAAGTCTGGTGG + Intergenic
1117873773 14:60228428-60228450 TTGTCATGAATGGAGTTTGCAGG + Intergenic
1118333023 14:64828395-64828417 TTGTTATGATAGAAGGCTGATGG - Intronic
1120834158 14:89026037-89026059 TTGTCAAGATGGGAGGCTGCAGG + Intergenic
1123479022 15:20614073-20614095 TTGTCATGAGTCAAGTCTGATGG - Intergenic
1123638990 15:22386312-22386334 TTGTCATGAGTCAAGTCTGATGG + Intergenic
1124119161 15:26874212-26874234 ATCTCATCAGAGAAGTCTGCTGG + Intronic
1130460625 15:84156419-84156441 GTGGCAGGATAGACGTCTGCGGG + Intergenic
1134571475 16:15294861-15294883 TTGTAATCATAGAAGACTGAAGG + Intergenic
1134730905 16:16461177-16461199 TTGTAATCATAGAAGACTGAAGG - Intergenic
1134936525 16:18250715-18250737 TTGTAATCATAGAAGACTGAAGG + Intergenic
1136006141 16:27330640-27330662 TTGTGATGATAGAACTGTGCTGG - Intronic
1139818004 16:69692675-69692697 TCATCATGTGAGAAGTCTGCTGG - Exonic
1141854975 16:86674551-86674573 CTGACATGATAGAAGTGGGCAGG - Intergenic
1143638999 17:8184699-8184721 TTGTCTTGACACTAGTCTGCTGG - Intergenic
1146581419 17:34041329-34041351 TTGTCATGATTCAAGACTGTTGG - Intronic
1147781147 17:42943056-42943078 TTTACTTGATGGAAGTCTGCTGG - Intergenic
1151571170 17:74926210-74926232 TGGTCATGATAGAGGGCTGGGGG - Intronic
1153824154 18:8859641-8859663 TTGCCATGAATGAAGTTTGCAGG + Intergenic
1156018800 18:32576525-32576547 TTAACTTGATAGAATTCTGCTGG - Intergenic
1156422980 18:36975938-36975960 TTGCCATTATAGAAGTCCTCTGG + Intronic
928081920 2:28319486-28319508 CTGGCATGTTAGAAGTCTGTGGG + Intronic
928406764 2:31020878-31020900 TTGGCATTATAGAAATGTGCAGG - Intronic
929325462 2:40605450-40605472 TTGTCAAGATAGAACTGAGCAGG + Intronic
930404727 2:50941045-50941067 TTCTCATGATAGAATTCTTATGG + Intronic
933331451 2:80897360-80897382 TTGTCATGCTAGAAGAGTTCAGG - Intergenic
938176221 2:129133131-129133153 TTGGCATGTTAGAATTATGCAGG + Intergenic
941246168 2:163099925-163099947 TTGTCCTTCTAGAATTCTGCAGG - Intergenic
944126440 2:196299036-196299058 TTGTCTTGCTAGAAGTCTCAAGG - Intronic
945312078 2:208325580-208325602 CTGTGATGATAGCAGTTTGCTGG + Exonic
947511858 2:230762555-230762577 TAGACATGATACATGTCTGCTGG + Intronic
947729543 2:232420388-232420410 TTGTCCTCGTGGAAGTCTGCGGG + Intergenic
948779209 2:240307389-240307411 TTGGCTTGATAGAAGACAGCTGG - Intergenic
1177337431 21:19749446-19749468 TTGTCCCACTAGAAGTCTGCAGG - Intergenic
1179176661 21:39012502-39012524 ATGGCATGAGTGAAGTCTGCTGG - Intergenic
1179471141 21:41611401-41611423 TTGCCAGGATGGATGTCTGCTGG + Intergenic
1183017909 22:35005076-35005098 CTGCCCTGATAGAAATCTGCAGG + Intergenic
1183575627 22:38687021-38687043 TTTTCATTATAAAACTCTGCCGG + Exonic
1185329598 22:50246202-50246224 TTGTCATGATAGCAGGCCTCTGG - Intronic
949484873 3:4528325-4528347 TTGTCAAGATAGATGAGTGCTGG + Intronic
951449244 3:22818343-22818365 TTCTCATGATAGAGTTCTACAGG - Intergenic
952739187 3:36719368-36719390 TTGTCAAAATACAAATCTGCAGG + Intronic
953740621 3:45535665-45535687 TTGTGATGATGGAACTCTTCTGG + Intronic
955752819 3:62199593-62199615 TTGTTTTTATAGAAGTTTGCAGG + Intronic
956465733 3:69519054-69519076 TGATCATGATGGAAGTCTGTGGG + Intronic
956538946 3:70312626-70312648 TTGTCAGGATAGAGGAATGCTGG - Intergenic
961483841 3:127203045-127203067 TTGGCAGGAAAGAAGACTGCTGG - Intergenic
965221088 3:165926259-165926281 TTGCCATGAAAAAAGTTTGCAGG + Intergenic
966157776 3:176935821-176935843 CTGTCTTCATATAAGTCTGCAGG - Intergenic
970036769 4:11745128-11745150 TTGTCATGATGAAAGTCTTCTGG - Intergenic
970308916 4:14761297-14761319 TGGTCATGATAAAAGGTTGCAGG + Intergenic
970525846 4:16931284-16931306 TACTCCTGTTAGAAGTCTGCCGG - Intergenic
971204467 4:24550155-24550177 CTGCCATGAAAGAAGTCTGCAGG + Intronic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972888539 4:43524815-43524837 TTGTCATAACAGAATACTGCAGG + Intergenic
975962767 4:79933162-79933184 TTTTCATGATAGCAGTCACCTGG - Intronic
980724831 4:136744604-136744626 TTGTTATGTTAGAATTATGCAGG - Intergenic
981635752 4:146877081-146877103 TTCACATGATAGGAGACTGCAGG + Intronic
983558017 4:169075779-169075801 TTCTCATGAAAGAATGCTGCTGG - Intergenic
990397078 5:55392999-55393021 TTGTCATTATTGCAGTCTGGTGG - Intronic
991362562 5:65836222-65836244 TTTGCATGATAGAAGTCAGATGG - Intronic
994244499 5:97464440-97464462 TTCTTATAATACAAGTCTGCTGG - Intergenic
994622192 5:102176934-102176956 TTATCAGGAAAGAAGTCTGAAGG + Intergenic
995683187 5:114743640-114743662 TATTCATGTTAGATGTCTGCAGG - Intergenic
1000878148 5:166666140-166666162 CTTTCAGGATAGAAGTCTGTAGG + Intergenic
1002533857 5:179865390-179865412 TTGTCATGTGAGACGGCTGCGGG + Intronic
1004976259 6:20970230-20970252 TTTTCATGATTGAAGGCTGTTGG + Intronic
1007794054 6:44333320-44333342 TTGACAAGATTGAAGTGTGCTGG + Intronic
1008569236 6:52799261-52799283 CTGCCATGATAGCAGTCTCCTGG + Exonic
1008573903 6:52840807-52840829 CTGCCATGATAGCAGTCTCCTGG + Exonic
1008793886 6:55276007-55276029 TTTTCATGATAGGAGTCTCCTGG + Intronic
1008837951 6:55860524-55860546 TTGTAATGCTAGAAGTGTGAAGG - Intronic
1009646389 6:66408203-66408225 TTGTCATGATTTAAGTTTTCTGG + Intergenic
1009815761 6:68732723-68732745 ATATCATGATAGGAGTCTGCAGG - Intronic
1010634935 6:78247296-78247318 TTGGCATGAGAGAATTCTACAGG - Intergenic
1011616892 6:89205658-89205680 TTGTGATGAGGGAGGTCTGCTGG + Intronic
1015840272 6:137469234-137469256 TTATCATGAATGAAGTTTGCAGG - Intergenic
1017315075 6:153021600-153021622 TTGACAGGATAGAAATCAGCTGG + Intronic
1017993924 6:159514305-159514327 TTGAGATGATATAAGTCTCCTGG - Intergenic
1021686315 7:23190318-23190340 TTGGCTTAATAGAAGACTGCTGG - Intronic
1022048301 7:26641051-26641073 TTTTCATGTTAGAAGTGTTCTGG - Intronic
1028033688 7:85951015-85951037 TTGTCATGATAAATGTCAGACGG - Intergenic
1028160701 7:87481620-87481642 TTGTCAAGATATAAGTCAACAGG - Intergenic
1028311064 7:89336585-89336607 TGGTGGTGATAGAAGTGTGCTGG - Exonic
1029126962 7:98301153-98301175 CTGTGTTGACAGAAGTCTGCTGG + Intronic
1034587184 7:152104271-152104293 TTTTCATGACAGCAGGCTGCAGG + Intronic
1036285981 8:7444529-7444551 TAGACATGGTAAAAGTCTGCTGG + Intronic
1036335492 8:7867000-7867022 TAGACATGGTAAAAGTCTGCTGG - Intronic
1037756126 8:21711108-21711130 TTTTCATAATACAAGGCTGCTGG + Intronic
1045798330 8:106072571-106072593 ATGTCCTGATAGATGTCTCCTGG + Intergenic
1048422750 8:134293642-134293664 TTGTAATTATAGTAGTTTGCTGG - Intergenic
1050261899 9:3849612-3849634 TTGTCATGAGAGAAGGCTAAGGG + Intronic
1051151106 9:14079941-14079963 GTGTCTTGGAAGAAGTCTGCTGG + Intergenic
1052365333 9:27606290-27606312 TAGAGAAGATAGAAGTCTGCTGG + Intergenic
1058862959 9:109135309-109135331 TTTTGAGGAGAGAAGTCTGCAGG - Exonic
1186625463 X:11288602-11288624 TTGTGATGATAGAAATGTTCTGG - Intronic
1188221495 X:27546558-27546580 ATGTCCTGGTAGAAGTCTGCTGG - Intergenic
1191643851 X:63457376-63457398 TAGTCATAATAGTAGTCTGGTGG - Intergenic
1192292509 X:69812641-69812663 TTGTCATGATAGAAGTCTGCAGG + Intronic
1193422456 X:81298299-81298321 TTGTCTTTTTAGAAGTCTTCAGG - Exonic
1194008622 X:88530423-88530445 TTGTTATGTTAGAATTATGCAGG - Intergenic
1202378622 Y:24258761-24258783 GTGGCAGGATAGACGTCTGCGGG - Intergenic
1202492160 Y:25411360-25411382 GTGGCAGGATAGACGTCTGCGGG + Intergenic