ID: 1192298395

View in Genome Browser
Species Human (GRCh38)
Location X:69874437-69874459
Sequence TTTTAAACATAAAGGGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2524
Summary {0: 1, 1: 10, 2: 349, 3: 767, 4: 1397}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192298395_1192298402 25 Left 1192298395 X:69874437-69874459 CCATCATCCCTTTATGTTTAAAA 0: 1
1: 10
2: 349
3: 767
4: 1397
Right 1192298402 X:69874485-69874507 GACATACCTTAAGATAATAAAGG 0: 1
1: 3
2: 41
3: 272
4: 686
1192298395_1192298401 3 Left 1192298395 X:69874437-69874459 CCATCATCCCTTTATGTTTAAAA 0: 1
1: 10
2: 349
3: 767
4: 1397
Right 1192298401 X:69874463-69874485 TCAGCAAAATCAGCATACAAGGG 0: 145
1: 307
2: 480
3: 468
4: 510
1192298395_1192298400 2 Left 1192298395 X:69874437-69874459 CCATCATCCCTTTATGTTTAAAA 0: 1
1: 10
2: 349
3: 767
4: 1397
Right 1192298400 X:69874462-69874484 CTCAGCAAAATCAGCATACAAGG 0: 146
1: 301
2: 473
3: 466
4: 620

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192298395 Original CRISPR TTTTAAACATAAAGGGATGA TGG (reversed) Intronic
Too many off-targets to display for this crispr