ID: 1192298637

View in Genome Browser
Species Human (GRCh38)
Location X:69877354-69877376
Sequence CAGTACGAAGAGATGGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 80}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192298637 Original CRISPR CAGTACGAAGAGATGGTAAC AGG (reversed) Intronic
906799132 1:48720889-48720911 CTTTAGGAATAGATGGTAACAGG + Intronic
907270403 1:53287838-53287860 CAGTGAGAAGAGATGGTGAGAGG + Intronic
908513245 1:64866900-64866922 TACTACGAAGTGATGGTGACTGG - Exonic
909502109 1:76346021-76346043 CAGGAGGAAGAGATGGTAGTGGG - Intronic
910874658 1:91867295-91867317 CAGTACGCACAGATGGTACGAGG + Intronic
911080827 1:93928501-93928523 CAGGAGGAAGAGAGGGTAAGTGG - Intergenic
919518259 1:198554493-198554515 CTGTAAGAAGAAATGGTCACAGG + Intergenic
923246194 1:232135112-232135134 CAGTACCTAGGGATGGGAACTGG + Intergenic
1065779552 10:29154273-29154295 CAGTAAGAAGACACGGAAACAGG + Intergenic
1067975859 10:51024750-51024772 CAGGAGGAAGAGAGGGAAACGGG + Intronic
1071021050 10:81057107-81057129 CAGTACAAAAAGAATGTAACAGG - Intergenic
1073664671 10:105517435-105517457 CAGTTCGAAGAAATGCTAAATGG + Intergenic
1074452953 10:113574270-113574292 CAGTCTGCAGGGATGGTAACAGG - Exonic
1080834097 11:35923874-35923896 CAGTAAGAAGAAATGGAAAAAGG - Intergenic
1080922750 11:36725077-36725099 TAGAAAGAAGAGATGGAAACTGG + Intergenic
1087560055 11:99777932-99777954 CAGGAAGAAGAAATGGTAATTGG + Intronic
1088256595 11:107909076-107909098 CAGCAAGAAGAGATGATAAGAGG - Intronic
1088631245 11:111775760-111775782 CAGTAGGCAGAGATGAGAACAGG - Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1089757695 11:120698549-120698571 CATTACTAAGAGATGGTAGTGGG - Intronic
1090023641 11:123149463-123149485 CAGAACCCAGAGATGGTGACTGG - Intronic
1093053416 12:14531207-14531229 GAATACAAAGAGATGGTACCTGG - Intronic
1093761183 12:22913355-22913377 AAACACCAAGAGATGGTAACGGG + Intergenic
1095523243 12:43093845-43093867 GAGTAAGAAGAGATTGTTACAGG + Intergenic
1100328538 12:93564914-93564936 CAGGAGGAAGAAATGGTCACTGG + Intergenic
1107451873 13:40517117-40517139 CTGCACGAAGAGATGGAAATTGG + Intergenic
1110315340 13:74100121-74100143 AAGGAAGAGGAGATGGTAACAGG + Intronic
1115912718 14:38274333-38274355 CAGTAGGAAGAGATGGAAAAAGG + Intergenic
1118172779 14:63405151-63405173 CAGGATGAAGTGATGTTAACTGG + Intronic
1121996061 14:98603969-98603991 GAGTAAGATGTGATGGTAACAGG + Intergenic
1122970473 14:105150149-105150171 CAGTACCAACAGATGGTCAGAGG + Intronic
1125738355 15:41943989-41944011 CAGGAGGAGGAGATGGTATCAGG - Intronic
1127397348 15:58553195-58553217 CAGCACAAAGAGCTGGCAACAGG + Intronic
1135668596 16:24356093-24356115 GGGTAGGAAGAGATGGTAAAGGG - Intronic
1136908073 16:34120385-34120407 CAGAAGCCAGAGATGGTAACTGG - Intergenic
1139453780 16:67054628-67054650 CAGTAAGAAAATAAGGTAACAGG - Intronic
1139615063 16:68084054-68084076 CAGTGGGAAGAGAGGGTAAAGGG - Intergenic
1143195079 17:5070003-5070025 CAGTATGAAGAGTGAGTAACTGG + Intergenic
1147340646 17:39751620-39751642 CAGTACTGAGAGAGGGTGACAGG + Intergenic
1158383562 18:56963476-56963498 TAGTTCTAAGAGATGGTAACAGG + Intronic
1158939026 18:62389785-62389807 TAGTACGAAGATCTGGTAACAGG - Exonic
1168570012 19:57458823-57458845 CAGAAAGAAGTGTTGGTAACTGG + Intronic
927874142 2:26643313-26643335 CAGTAAGAAGAGATGCTGCCAGG - Intergenic
931471866 2:62546183-62546205 GAGTAAGAAGAGATGGTGCCTGG + Intergenic
931861867 2:66363183-66363205 AAGTAAGAAGAGATAGTAAAAGG + Intergenic
933290661 2:80434862-80434884 CACTATGGAGAGATGCTAACTGG + Intronic
937610080 2:123850584-123850606 CAGTAGGAAGAGAGGGCAAAGGG - Intergenic
1171903506 20:30878949-30878971 CAGAAGCCAGAGATGGTAACTGG - Intergenic
1175254568 20:57632348-57632370 CAGAAAGAATAGATGGTAGCCGG + Intergenic
1175988724 20:62777077-62777099 CAGGAGGAGGAGATGGGAACAGG + Intergenic
1180318367 22:11298323-11298345 CAGAAGCCAGAGATGGTAACTGG + Intergenic
1180336902 22:11584908-11584930 CAGAAGCCAGAGATGGTAACTGG - Intergenic
950591157 3:13936349-13936371 CAGTACACAGAGATGGAAACAGG - Intergenic
951152310 3:19305840-19305862 CAAAACGAAGAGATGGAAAGAGG + Intronic
953386312 3:42508039-42508061 CAGTACGGGGCGAAGGTAACTGG + Intronic
959099053 3:101989825-101989847 CAGTAGGAAGATAAGGTAAGAGG - Intergenic
959769003 3:110070560-110070582 CAATAGGAACAGATTGTAACTGG - Intergenic
963530100 3:146463725-146463747 CAGTAGGAGGAGTTGGTAAAAGG - Intronic
964073357 3:152663239-152663261 CAGAACAAAGAGAAGGTAAGAGG + Intergenic
964827055 3:160840111-160840133 CAGTAGGAACAAATGGTAAGTGG + Intronic
966894450 3:184432973-184432995 CAATACAAAGAAATGGTCACAGG + Intronic
974645824 4:64690683-64690705 CAGTACCTAGTGATGGTAAATGG - Intergenic
976479363 4:85521640-85521662 CAGTATGTAGAGATGCTAAAAGG - Intronic
979537748 4:121842743-121842765 GAGCAGGAGGAGATGGTAACTGG - Intronic
981773012 4:148331808-148331830 CAGTAATAAGAGATGGTACTTGG - Intronic
987036834 5:14027624-14027646 CAGAAAGGAGAGATGGTAACTGG - Intergenic
990550579 5:56873511-56873533 CAATCAGAAGAGATGGTAAAGGG - Intronic
1000340256 5:160271536-160271558 CAGTCTGCAGAGATGGGAACAGG + Intronic
1000728801 5:164804971-164804993 CATAACTTAGAGATGGTAACAGG - Intergenic
1001441687 5:171748672-171748694 CAGAGCGATGAGATGGTCACTGG + Intergenic
1012949351 6:105501604-105501626 CAGTAAGAAGAGGTGGTTGCTGG + Intergenic
1015585887 6:134775986-134776008 CAGTAAATAGAGCTGGTAACTGG + Intergenic
1022162998 7:27730859-27730881 CAGTGTGAAGGGATGGTAAAGGG + Intergenic
1028242283 7:88435970-88435992 CAGTACACATAGATTGTAACTGG - Intergenic
1030903368 7:115151424-115151446 CAGATCCAAGAGATGGTAAGTGG - Intergenic
1045704158 8:104900656-104900678 TAGTAGGAAGAGATTGTAACAGG + Intronic
1045984215 8:108229666-108229688 CAGTACGGAGAGAGGGAGACAGG + Intronic
1047435196 8:124830162-124830184 CAGTGAGAAGACATGGTCACAGG + Intergenic
1047772556 8:128042043-128042065 CAGTACCAAGAGATGCTAAATGG - Intergenic
1048605758 8:135967150-135967172 CAGAAAGAATAGATGGTACCTGG - Intergenic
1049326852 8:142026029-142026051 CAGTGCCAAGAGATGGCACCTGG - Intergenic
1051596129 9:18825971-18825993 CAGTACAAAGAGGAGGAAACAGG - Intronic
1055213751 9:73833294-73833316 CAGTACAAAGAGATGGAATTTGG + Intergenic
1203366595 Un_KI270442v1:264085-264107 CAGAAGCCAGAGATGGTAACTGG + Intergenic
1190404507 X:50073236-50073258 CACTAGGTAGAGATGGTAAGAGG + Intronic
1192298637 X:69877354-69877376 CAGTACGAAGAGATGGTAACAGG - Intronic
1194593980 X:95835836-95835858 CAGTGAGAAGATATGGAAACAGG + Intergenic
1194725668 X:97393216-97393238 CAGTTTGAGAAGATGGTAACAGG + Intronic