ID: 1192302196

View in Genome Browser
Species Human (GRCh38)
Location X:69916750-69916772
Sequence CTGTGTGAAAGTACCTAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192302191_1192302196 29 Left 1192302191 X:69916698-69916720 CCCGGCCTAATCTCTTTTCTTAT 0: 1
1: 0
2: 23
3: 138
4: 1374
Right 1192302196 X:69916750-69916772 CTGTGTGAAAGTACCTAGTATGG 0: 1
1: 0
2: 0
3: 5
4: 108
1192302192_1192302196 28 Left 1192302192 X:69916699-69916721 CCGGCCTAATCTCTTTTCTTATG 0: 1
1: 0
2: 0
3: 52
4: 641
Right 1192302196 X:69916750-69916772 CTGTGTGAAAGTACCTAGTATGG 0: 1
1: 0
2: 0
3: 5
4: 108
1192302195_1192302196 24 Left 1192302195 X:69916703-69916725 CCTAATCTCTTTTCTTATGGGTA 0: 1
1: 0
2: 2
3: 20
4: 320
Right 1192302196 X:69916750-69916772 CTGTGTGAAAGTACCTAGTATGG 0: 1
1: 0
2: 0
3: 5
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192302196 Original CRISPR CTGTGTGAAAGTACCTAGTA TGG Intronic
900702483 1:4056874-4056896 GTATGTGAAATTACTTAGTATGG - Intergenic
901592666 1:10358525-10358547 TTTTGTCAAAGTACCTAGAAGGG - Intronic
906639156 1:47431292-47431314 ATGTGTGAAATTAACTAGGAAGG + Intergenic
913214475 1:116609101-116609123 CAGTGGGAAAGTACCTACTAAGG - Intronic
918869081 1:189943489-189943511 CTGTGTGAAAGTATTTATCAAGG + Intergenic
919068344 1:192722521-192722543 ATGTCAGAAAGTACCAAGTAAGG + Intergenic
1073919837 10:108446048-108446070 CTGTGAGACAATACATAGTATGG + Intergenic
1075455241 10:122580744-122580766 CTGTGTGATAGGAACTAGGATGG + Intronic
1075457364 10:122593447-122593469 CTGTGTGATAGGAACTAGGATGG + Intronic
1075458437 10:122599943-122599965 CTGTGTGATAGGAACTAGGATGG + Intronic
1075458942 10:122602978-122603000 CTGTGTGATAGGAACTAGGATGG + Intronic
1075459574 10:122607037-122607059 CTGTGTGATAGGAACTAGGATGG + Intronic
1075460206 10:122611096-122611118 CTGTGTGATAGGAACTAGGATGG + Intronic
1075460838 10:122615155-122615177 CTGTGTGATAGGAACTAGGATGG + Intronic
1079961767 11:26933046-26933068 CTGTGTGAACGTGGCCAGTAAGG + Intergenic
1080106303 11:28514477-28514499 TTGTGTGAAAAAAGCTAGTATGG - Intergenic
1081215753 11:40395393-40395415 ATGAGAGAAAGTACCTAGTTAGG - Intronic
1087208323 11:95419774-95419796 GTGTGTGAAAGTGCCTGGCATGG - Intergenic
1087324524 11:96705195-96705217 CTGTGTGAAAAGACCAAGAAAGG + Intergenic
1088379267 11:109175274-109175296 ATGTATGAAAGTGCCTAGTATGG + Intergenic
1088608578 11:111555363-111555385 CTGTGGGAAAGAACAAAGTAGGG - Intronic
1090429898 11:126636956-126636978 CGATGTGAAAGTCCCTAGGAGGG + Intronic
1093594786 12:20947383-20947405 ATGATTGAAAGTATCTAGTAAGG + Intergenic
1093620219 12:21279137-21279159 CTGTTTGAAAATACACAGTAAGG + Intronic
1096830191 12:54307768-54307790 ATGTGTGAAAGTAGCCAGAAAGG - Intronic
1097954650 12:65470980-65471002 GTTTGTGATAGTACCTAGCAGGG - Intronic
1099500944 12:83413769-83413791 CTGTGGGTATATACCTAGTAAGG + Intergenic
1105893504 13:24699004-24699026 CTGTGTGACAGCACCAAGCAGGG + Intronic
1106829755 13:33567135-33567157 GTGAGTGTGAGTACCTAGTAGGG - Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1121303040 14:92887000-92887022 ACGTGGGAAAGTACCTAGTGAGG - Intergenic
1127254978 15:57282326-57282348 CTATGTGATGGTACTTAGTATGG + Intronic
1130049633 15:80473071-80473093 CTGTGTGTGAGGACTTAGTAAGG - Intronic
1134395456 16:13858448-13858470 CTGTGTGAAATCACTTAGAAAGG + Intergenic
1138929859 16:61639800-61639822 CTTCGTGAAAGAACCTAATAAGG - Intergenic
1142738319 17:1915816-1915838 CTGTGTGAGAGCACCAAGGATGG + Intergenic
1147201060 17:38801459-38801481 CTTTGTGAAAATACCTTGTTTGG - Exonic
1148998581 17:51733991-51734013 GTGTGTGAAAGCTACTAGTATGG + Intronic
1152019879 17:77775423-77775445 GTCTGTGAAAGTACTTTGTAAGG + Intergenic
1155847133 18:30722133-30722155 ATGTGTGAAATTATCTAGTCAGG - Intergenic
1158539315 18:58338613-58338635 CTGTATGAAAGTAACCTGTATGG + Intronic
1161384129 19:3982039-3982061 CTGGGTCAAAGTACCTGGCAAGG + Exonic
1167077540 19:47258492-47258514 CTGGGGGAAAGTCCCTGGTATGG + Intronic
925656399 2:6154644-6154666 CTGAGTGAAAGTTCACAGTAAGG + Intergenic
929260773 2:39864281-39864303 CTGTGTGAAAGCAGCCAGGAGGG + Intergenic
930129902 2:47839389-47839411 CTGTGGGAAAGTAACAAATAGGG - Intronic
933361467 2:81291694-81291716 CTGTGGGAAACTATCCAGTAGGG - Intergenic
934296094 2:91744060-91744082 AAGTGGGAAAGTACCTACTAAGG + Intergenic
1168901363 20:1367825-1367847 CTGTGCGAAAGGACATAGTGTGG + Intronic
1169149912 20:3281402-3281424 CTGTTTAATAGTACATAGTAAGG - Intronic
1169855684 20:10100029-10100051 CTCTGTGAAAGAACCTATTAAGG + Intergenic
1169902049 20:10562913-10562935 TTTTGTTAAAATACCTAGTAGGG + Intronic
1170606525 20:17878800-17878822 CTGTGTGCATGTACCTACCATGG - Intergenic
1171062538 20:21980182-21980204 CTTTTAGAAAGTACCTACTAAGG + Intergenic
1172845832 20:37929610-37929632 CTGTGTGAAAATAGCTTGTTGGG + Intronic
1180223108 21:46372055-46372077 CTGTGTGCATGTGCCTTGTATGG - Intronic
1182768451 22:32775789-32775811 CTGTTTCTAAGTACCTACTAAGG + Intronic
949632519 3:5943989-5944011 CTGGGAGACAGTTCCTAGTAGGG - Intergenic
963409888 3:144913576-144913598 CTGTTTGAAAGTAACAATTATGG + Intergenic
970302253 4:14693423-14693445 CTCTGTTAAAATACCTAGCATGG - Intergenic
974279333 4:59771595-59771617 CTGAGTGAAAGTAACCAGTTTGG - Intergenic
977103698 4:92852389-92852411 CTGAGGGAAAGGAGCTAGTAGGG - Intronic
977987920 4:103406486-103406508 CTGTGTGAAAATACCTTTTGTGG + Intergenic
978113222 4:104987518-104987540 TTCTATGCAAGTACCTAGTATGG + Intergenic
983929114 4:173434033-173434055 CTCTGTTAAAATACCTAGTGTGG + Intergenic
984364112 4:178776030-178776052 CTGTGTGAAGGTAGCTGGCATGG + Intergenic
986925107 5:12738194-12738216 ATGTGTGTAAGTATCTAGGAGGG + Intergenic
987814348 5:22881195-22881217 CTGTATGAAAGTTCCTCGAAAGG - Intergenic
988442128 5:31244990-31245012 CAGTGTCAAAGTTGCTAGTAAGG - Intronic
988738695 5:34048396-34048418 CTGTGTTAAAATATCTAGTGTGG - Intronic
989204218 5:38795652-38795674 CTGAGTCAATGTACTTAGTATGG - Intergenic
991007204 5:61841033-61841055 TTGTGTGCAAGTACTTGGTAAGG + Intergenic
994400073 5:99267530-99267552 CTGGGAGACAGTACCTTGTAAGG + Intergenic
994990159 5:106985952-106985974 CTGTGTTAAAATACCTACTATGG + Intergenic
996131543 5:119787524-119787546 CTGTGAGAATTTTCCTAGTAAGG + Intergenic
998566250 5:143218372-143218394 CTATGTGCAAGGACCTAGCATGG + Intronic
1000088379 5:157908783-157908805 ATGTGTGACAGTACATAGTCTGG + Intergenic
1001854820 5:175001856-175001878 TTGTGTGAATGTACCTAGCCTGG - Intergenic
1003045972 6:2733035-2733057 CTGTGTGAAAGCAGATAGAAGGG - Intronic
1003083010 6:3037461-3037483 CTGTCTGAAATTACCTAATTTGG - Intergenic
1004458008 6:15809682-15809704 CTCTGTTAAAGTAACTAGCATGG - Intergenic
1005608126 6:27495941-27495963 CAGTGTGAAATTACCTAACAAGG + Intergenic
1007642371 6:43352303-43352325 CTGTGTGAGAGTACCAAATTTGG + Intronic
1009758137 6:67967588-67967610 CACTGTGAAATTAACTAGTATGG - Intergenic
1010845920 6:80707165-80707187 CTGGCTGAAAGTATATAGTAAGG + Intergenic
1013212940 6:108002946-108002968 CTGTTTGCAAGCACCTAGTAGGG + Intergenic
1013645426 6:112134357-112134379 GTGTGTAAAAGTAGCAAGTAAGG + Intronic
1013688423 6:112612030-112612052 CTGTTTGAAAGTTGCTAATATGG + Intergenic
1019470921 7:1220239-1220261 CTGTGTGTAAGTAGCTGGAAGGG + Intergenic
1020790214 7:12617947-12617969 CTGTGTTATAGTAACTTGTAAGG + Intronic
1022710912 7:32849186-32849208 ATGTCTGAAAGTACCTACCAAGG - Intergenic
1022913740 7:34925740-34925762 ATGTCTGAAAGTACCTACCAAGG + Intergenic
1027982673 7:85246619-85246641 ATGTGTGAAAATACCAAGTTTGG + Intergenic
1028882767 7:95898514-95898536 CTGTGAGCAAGTATCTACTAGGG - Intronic
1029794935 7:102884201-102884223 CTGTGTAAAAGTAGGTAGTTGGG - Exonic
1030562301 7:111104533-111104555 ATATGTGAAACTACTTAGTATGG + Intronic
1032335085 7:131017691-131017713 CTGAGTGAAAGTTCCTTGTGGGG - Intergenic
1032732892 7:134661684-134661706 CTGTGTGAATGGACCGATTAAGG - Exonic
1033127142 7:138716323-138716345 CTGTGTGGAAGTTTCTAGAAAGG + Intronic
1042207714 8:66345761-66345783 GTGTGTGGAAGTAACTAGAAGGG + Intergenic
1042691278 8:71502014-71502036 GCATGTCAAAGTACCTAGTAAGG + Intronic
1047512070 8:125523019-125523041 CTGTGGGTAAGGATCTAGTATGG - Intergenic
1052041316 9:23742043-23742065 CTTTGTAAAAGTAACTAGAAGGG + Intronic
1055198560 9:73627096-73627118 ATGAGTGAAAGTATCTGGTAAGG + Intergenic
1186122224 X:6375525-6375547 CTGTCTGAAAGTATCAAGAATGG - Intergenic
1188489017 X:30716804-30716826 CTGTGTTAGAGTCCCTTGTAAGG + Intronic
1189051516 X:37650404-37650426 TTGAGTGAAAGGATCTAGTATGG + Intronic
1189714900 X:43855179-43855201 CTGTTTGAAAGTTGCTATTAAGG - Intronic
1191953392 X:66618321-66618343 ATGTGTAAAACTACCTAATAAGG + Intronic
1192302196 X:69916750-69916772 CTGTGTGAAAGTACCTAGTATGG + Intronic
1192987339 X:76414453-76414475 CTGTGGGTAGATACCTAGTAGGG - Intergenic
1196975954 X:121157875-121157897 TTGTGTGTAAGTATGTAGTAGGG - Intergenic
1197176425 X:123491026-123491048 CTTTGTGAAAGTCACCAGTAAGG - Intergenic
1199419376 X:147626504-147626526 CTGTGTGAATGTGGATAGTATGG - Intergenic