ID: 1192303239

View in Genome Browser
Species Human (GRCh38)
Location X:69928717-69928739
Sequence ACAGCACATAATTGTAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192303239 Original CRISPR ACAGCACATAATTGTAAACC AGG Intronic
900560095 1:3300493-3300515 ACAGCACATCATCTTCAACCAGG - Intronic
901962367 1:12837723-12837745 GCTGCACACACTTGTAAACCTGG + Intergenic
904955111 1:34276658-34276680 ACAGCACATACATTTTAACCTGG - Intergenic
908777521 1:67655594-67655616 ACAGCAAACAATTATAAAGCTGG + Intergenic
909995705 1:82276701-82276723 ACAGAAGGTAATTGTAAACAGGG - Intergenic
916693349 1:167212275-167212297 AGAGCACATAAATGCAGACCAGG - Intergenic
916855080 1:168741037-168741059 ACAGCACATAATCTAAGACCTGG + Intergenic
917150483 1:171938451-171938473 CAAGCACATAATTTTAAATCTGG + Intronic
918709904 1:187713968-187713990 ACAGCACATATTTAAAAAGCTGG + Intergenic
919384646 1:196905188-196905210 ACACAATATAATTGTAAACCAGG + Exonic
924862822 1:247943538-247943560 ACATCAAATTATTGTAAATCTGG - Intronic
924871515 1:248051876-248051898 TCATCAAATTATTGTAAACCTGG - Intronic
1065895643 10:30161027-30161049 ACCGCACATAACTGGAAAACAGG + Intergenic
1070096946 10:73346593-73346615 AGATCACACAATTGCAAACCAGG + Intronic
1071102625 10:82056762-82056784 AGAGAACATAATTGTTAACCTGG - Intronic
1071752451 10:88495921-88495943 ACAGAACATATTTGAAAAACTGG + Intronic
1074622593 10:115141040-115141062 CAAGCACATAATTATAAACAGGG - Intronic
1083604740 11:63971527-63971549 TCATGACATTATTGTAAACCTGG + Intergenic
1085328126 11:75624300-75624322 ACAGCACATCACTGTCACCCTGG - Intronic
1086814369 11:91350403-91350425 ACTGGACATCAATGTAAACCCGG - Intergenic
1087808336 11:102580889-102580911 ACAGCACAATATTATAAATCAGG - Intronic
1089453373 11:118611553-118611575 ACAGCTCATAATAATAAACGGGG + Intronic
1095377732 12:41550839-41550861 ACAGCACATCATTTTTAAACAGG + Intronic
1098058772 12:66538038-66538060 ACAGCACACAATTTAAAACAGGG - Intronic
1098892611 12:76024688-76024710 ACAGCTAATAATTGTGAAACTGG + Intergenic
1102810907 12:115823505-115823527 ACAGCCCAGAATTTAAAACCTGG - Intergenic
1102830648 12:115995792-115995814 TCAGCACTTTATTGTAAAACAGG - Intronic
1104241141 12:126990732-126990754 ACAGCAGCTATTTGTAACCCAGG + Intergenic
1105432971 13:20353935-20353957 AGAGAAAATAATTGTCAACCTGG + Intergenic
1107213184 13:37883563-37883585 AAAGCACATTTTTGTATACCTGG + Intergenic
1107598739 13:41991008-41991030 ACAGCACATAAATATGAACAGGG + Intergenic
1109180243 13:59205196-59205218 ACAGCAGTAAATGGTAAACCTGG - Intergenic
1110587623 13:77213171-77213193 AGAGCACAAAAATGTAAACAGGG + Intronic
1112964770 13:105175617-105175639 AGAGCAAATAATTGTAAATTGGG + Intergenic
1115844982 14:37519862-37519884 ACACCATATAATTAAAAACCTGG - Intronic
1116110965 14:40580538-40580560 ATGACACATAATTTTAAACCTGG + Intergenic
1116222290 14:42104033-42104055 ACATCACATAATTTTGAAACTGG + Intergenic
1119256557 14:73202817-73202839 GCAGCACATAATAGTAAAATTGG + Intronic
1120550326 14:85863436-85863458 ACAGCATAAAATGGTAAACTTGG + Intergenic
1120651468 14:87138893-87138915 ACAGAAAATAATTTTAAAGCAGG - Intergenic
1121289298 14:92761260-92761282 ACAGAACGAAATTGTAACCCGGG - Intergenic
1123139543 14:106061941-106061963 TCAGTACAGAATTGTAAATCTGG + Intergenic
1123156780 14:106234853-106234875 TCAGTACAGAATTGTAAATCTGG + Intergenic
1123207551 14:106727954-106727976 TCAGTACAGAATTGTAAATCTGG + Intergenic
1127241660 15:57122413-57122435 TCAGCACATACCTGTAAGCCAGG + Intronic
1130518061 15:84641373-84641395 ACACCACAGAATAGTAAACTGGG - Exonic
1131604044 15:93881640-93881662 AAAGCTCCTAAATGTAAACCAGG - Intergenic
1132269532 15:100511767-100511789 ACAGAACATTAATGGAAACCAGG - Intronic
1133198174 16:4185165-4185187 ACAGCGCACAATTGCAAATCAGG - Intergenic
1135074757 16:19383593-19383615 ACAGGAAATAATCGGAAACCAGG - Intergenic
1135466746 16:22693191-22693213 ACAGCACATAACTATAAGCAGGG - Intergenic
1144092329 17:11869130-11869152 ACAGCACCTTAATGAAAACCTGG + Exonic
1147494407 17:40902192-40902214 ACTGCAGATAATTGTAAACCTGG - Intergenic
1153170615 18:2311821-2311843 ACAGCCCATGATTGTTATCCTGG - Intergenic
1155349531 18:24892843-24892865 ACAGCACTTAGAGGTAAACCAGG + Intergenic
1155406283 18:25491352-25491374 ACAGGACAAAATGGTTAACCTGG + Intergenic
1156802084 18:41128082-41128104 ACAGCACAAAATTATAATACAGG - Intergenic
1156949398 18:42875632-42875654 ATAGAATATAATTGGAAACCAGG + Intronic
1157137518 18:45071280-45071302 ACAGAGTATAATTGTCAACCAGG + Intergenic
1158510005 18:58082009-58082031 ACAGGAAATGATTGTAATCCAGG + Intronic
1158644776 18:59236304-59236326 AGACCACATGTTTGTAAACCTGG - Intergenic
1159493685 18:69172420-69172442 ATAGAACATAATAGAAAACCTGG + Intergenic
1159561418 18:69999285-69999307 ACAGAATATAACTTTAAACCAGG + Intergenic
1161656722 19:5520637-5520659 ATAACACATAACTGTAAGCCAGG + Intergenic
1163918383 19:20263851-20263873 ACGGCACATACTTGTAATCCAGG + Intergenic
1164715695 19:30388841-30388863 CCAGCACATGATTTTAAGCCTGG - Intronic
925031960 2:657419-657441 ATAGAAAATAATTGTCAACCTGG - Intergenic
930295145 2:49544857-49544879 TCAGTACATAATTGTACATCTGG + Intergenic
930844144 2:55883346-55883368 ACAGCAGATAATTTCAAAGCAGG - Intronic
936030810 2:109068692-109068714 ACAGCTCATAATGGCCAACCTGG - Intergenic
937390026 2:121477815-121477837 ACAGCACACAACTGTGTACCAGG + Intronic
940472021 2:154112600-154112622 TCAGCATATAATTGTACATCTGG + Intronic
941419428 2:165264061-165264083 TGAGGACATAATTGTATACCTGG - Intronic
941424420 2:165324052-165324074 ACAGCCCATGATTCCAAACCAGG - Intronic
942377062 2:175348335-175348357 AGATCACAGAATTCTAAACCAGG - Intergenic
943046717 2:182868635-182868657 ACACTAGATAATTGTAGACCAGG - Intergenic
944001252 2:194841183-194841205 ACAGCCCGCAAATGTAAACCAGG + Intergenic
945471252 2:210229902-210229924 AAAGCACATAAATATAAATCAGG + Intergenic
947678480 2:232007384-232007406 ATAGAAAATAATTGGAAACCTGG + Intronic
947973093 2:234340954-234340976 ACAGCACATTATTATATGCCAGG + Intergenic
1172155196 20:32819506-32819528 ACAGAAATTAATTGTAAGCCTGG + Intergenic
1172331056 20:34076502-34076524 ACAGCACACACTTCTGAACCTGG - Intronic
1173192314 20:40886099-40886121 ACAGCCCAGGATGGTAAACCAGG + Intergenic
1173274921 20:41572174-41572196 AGAGCACATGATGCTAAACCTGG + Intronic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1178464387 21:32833394-32833416 ACAGAACATACTTGAAAACCTGG - Intergenic
1178624931 21:34206927-34206949 ATAGCACAGAATTGAAACCCTGG - Intergenic
1179137699 21:38695180-38695202 ACTCCCCATAATTTTAAACCAGG + Intergenic
951141044 3:19160612-19160634 ACAGAACATAATTGAAATCATGG - Intronic
953595986 3:44314486-44314508 ACAACAAATAAGTGTAAAGCAGG + Intronic
953769434 3:45767880-45767902 AGAGAAAATAATTGTTAACCTGG + Intronic
955727223 3:61946095-61946117 ACAGCACAAAATTAAAAACTTGG + Intronic
956813963 3:72890867-72890889 ACAGAACAAAATTTTAAAACTGG + Intronic
957856137 3:85881553-85881575 ACAGCCCATAATTGAAAGCTAGG - Intronic
957901647 3:86501809-86501831 ACATCAAATATTTGAAAACCTGG + Intergenic
959877832 3:111406886-111406908 AAAGCACAAAATTGTAAAATTGG - Intronic
961175653 3:124832936-124832958 ACAGCACATAAGGGAAAACAAGG + Intronic
965704631 3:171493930-171493952 ACAGCACATAAATTAGAACCTGG - Intergenic
965883994 3:173421819-173421841 ACAAAACATAATTCTAAACTGGG - Intronic
966556475 3:181267224-181267246 TCAGAACATCATTGAAAACCTGG + Intergenic
970157854 4:13159540-13159562 ACAGCACACATGTGTAAACACGG + Intergenic
971588402 4:28434638-28434660 ACAGCACACAATTGGAAATCTGG + Intergenic
975271845 4:72444437-72444459 ACAGGCAGTAATTGTAAACCTGG - Intronic
975744779 4:77465408-77465430 ACAGCACATAATTAAAACCAAGG + Intergenic
976715840 4:88121911-88121933 ACAGCAAATAAGTGGATACCTGG + Intronic
977520346 4:98074907-98074929 ACAGCACTTAATTATAATCCAGG - Intronic
977839043 4:101679041-101679063 ATAGCACATACATGTAAAACAGG - Intronic
978232910 4:106422786-106422808 AAAGTACTTAATTATAAACCAGG + Intergenic
978420808 4:108531016-108531038 ACACCACATCCTTGGAAACCAGG - Intergenic
980184540 4:129445852-129445874 AAAACACATTATTATAAACCAGG - Intergenic
981672661 4:147305066-147305088 AAAGCACTTAATTCTAGACCAGG - Intergenic
984073257 4:175143482-175143504 ATAGCATATAATTTTAAATCAGG + Intergenic
987115341 5:14722175-14722197 ACAGCACATCATGGTCAACTGGG - Intronic
987647035 5:20686935-20686957 ACATTACAAAATTGAAAACCAGG - Intergenic
990886023 5:60594652-60594674 ACAGCAGATAAATGGGAACCAGG + Intergenic
995353436 5:111209602-111209624 ACAGGACTTATTTGTAAAGCTGG - Intergenic
997150236 5:131485727-131485749 ACTGAACTTAATAGTAAACCTGG - Intronic
998306780 5:141085280-141085302 ACAGCACATTATTGTGAACATGG - Intergenic
998725832 5:145013582-145013604 ACAGCACATGAGTTTAAAACTGG - Intergenic
1000522369 5:162311842-162311864 AAAGCACACAATTGTCAACCAGG + Intergenic
1004771061 6:18782241-18782263 ACAGCACATAATGGCAAAGAAGG + Intergenic
1005080949 6:21956100-21956122 ACAGCACATAATTGTACGACTGG + Intergenic
1005148777 6:22723425-22723447 ACAACATGCAATTGTAAACCAGG - Intergenic
1005309573 6:24546595-24546617 ATAGCACAGAATTAAAAACCAGG + Exonic
1009826266 6:68868977-68868999 AAAGCACAGAATTTTAAAGCTGG - Intronic
1011056010 6:83204224-83204246 ACAGCATATAATTGTAGGCTGGG + Intergenic
1012843267 6:104356593-104356615 AAAGCACATACATGTAAAGCAGG - Intergenic
1013192525 6:107815798-107815820 TCACCTCAGAATTGTAAACCAGG + Intronic
1014469347 6:121796210-121796232 AAAGCTGATAATTGTGAACCAGG - Intergenic
1021935563 7:25627719-25627741 ACAGCTAGTAATTGAAAACCAGG + Intergenic
1022030193 7:26485725-26485747 ACAGCAAATTATTCTAAACAGGG + Intergenic
1026332374 7:69363953-69363975 ACAGTACCTGATTGGAAACCTGG + Intergenic
1027007412 7:74707149-74707171 ACAGAACAGAATTATAAACGGGG - Intronic
1030530138 7:110701793-110701815 AGATCACAAAATTGCAAACCAGG + Intronic
1033059526 7:138092416-138092438 GCAACACATAATTGTACACTGGG - Intronic
1034008797 7:147505540-147505562 TCAGCACTTAGTTGTAAATCTGG + Intronic
1041249922 8:55924099-55924121 GCAGCATATATTTGTAAAACTGG - Intronic
1043705040 8:83338347-83338369 GCAGCAGATAAAGGTAAACCGGG - Intergenic
1044710954 8:95057331-95057353 AGAGCACATGATTTTCAACCAGG - Intronic
1047448904 8:124944866-124944888 ACATCACAGAGCTGTAAACCAGG + Intergenic
1052676370 9:31630394-31630416 ACAGCACATATTTGTAATTCTGG - Intergenic
1053322476 9:37112147-37112169 AGAGCACACAATTTTCAACCAGG - Intergenic
1055433287 9:76266905-76266927 GGAGCACAAAACTGTAAACCTGG + Intronic
1057507665 9:95649053-95649075 ATAGAACATATTTGAAAACCTGG + Intergenic
1059776417 9:117479783-117479805 ACTGCAAATAATTGTGATCCAGG - Intergenic
1185950566 X:4428047-4428069 ATAGAACAAAATTGTACACCAGG - Intergenic
1186420028 X:9418267-9418289 GCAACACAAAATAGTAAACCAGG - Intergenic
1186874279 X:13801707-13801729 ACAGCACATGAATATAAACAAGG + Intronic
1188467202 X:30495432-30495454 ACAACAGATAATTGAAAAACTGG + Intergenic
1190027619 X:46940098-46940120 ACTCAACATTATTGTAAACCAGG - Intronic
1192302462 X:69919433-69919455 ACACCACATACTTGTTAATCTGG - Intronic
1192303239 X:69928717-69928739 ACAGCACATAATTGTAAACCAGG + Intronic
1196256021 X:113520109-113520131 CCAGCACATAATTATATGCCTGG + Intergenic
1196492490 X:116284667-116284689 AGAGCACATATTTCTCAACCTGG + Intergenic
1197597825 X:128488397-128488419 ACAGCACAATATTGTAACCCAGG + Intergenic
1197972143 X:132125863-132125885 ACAGCATATAATTGCAGAGCTGG - Intronic